header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-090206-5
Morpholino Name: MO1-gpr161
Target: gpr161 (1)
Previous Name: MO#24 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CGTCCCATTCTTAGAGCCGTTCATT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: ATG-targeting morpholino
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-gpr161 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-gpr161
Expressed Gene Anatomy Figures
bmp4 Fig. 4 with image from Leung et al., 2008
foxa3 Fig. 5 with image from Leung et al., 2008
lft1 Fig. 3 with image from Leung et al., 2008
lft2 Fig. 3 with image from Leung et al., 2008
myl7 Fig. S3 with image from Leung et al., 2008
nkx2.5 Fig. S4 with image from Leung et al., 2008
spaw Fig. 3 with image from Leung et al., 2008
tbxta Fig. 3 with image from Leung et al., 2008
PHENOTYPE
Phenotype resulting from MO1-gpr161
Phenotype of all Fish created by or utilizing MO1-gpr161
OTHER MO1-gpr161 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)