ZFIN ID: ZDB-MRPHLNO-060811-1
Morpholino Name: MO1-dcaf7
Target: dcaf7 (1)
Previous Names: MO1-wdr68, wdr68MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CGTTTACCGTGCAACGACATGCTTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-dcaf7 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-dcaf7
Expressed Gene Anatomy Figures
dlx3b Fig. 5 with image from Nissen et al., 2006
hand2 Fig. 5 with image from Nissen et al., 2006
lft1 Fig. 4 from Mazmanian et al., 2010
lft2 Fig. 4 from Mazmanian et al., 2010
sox9a Fig. 5 with image from Nissen et al., 2006
spaw Fig. 5 from Mazmanian et al., 2010
PHENOTYPE
Phenotype resulting from MO1-dcaf7
Phenotype Figures
ceratohyal cartilage aplastic, abnormal Fig. 4 with image from Nissen et al., 2006
determination of left/right asymmetry in diencephalon process quality, abnormal Fig. 4 from Mazmanian et al., 2010
determination of left/right asymmetry in lateral mesoderm process quality, abnormal Fig. 4Fig. 5 from Mazmanian et al., 2010
heart physical object quality, abnormal Fig. 4 from Mazmanian et al., 2010
heart morphogenesis process quality, abnormal Fig. 4 from Mazmanian et al., 2010
Meckel's cartilage aplastic, abnormal Fig. 4 with image from Nissen et al., 2006
Meckel's cartilage aplastic/hypoplastic, abnormal Fig. 1 with image from Wang et al., 2013
Meckel's cartilage decreased size, abnormal Fig. 4 with image from Nissen et al., 2006
metapterygoid morphology, abnormal Fig. 4 with image from Nissen et al., 2006
palatoquadrate cartilage aplastic, abnormal Fig. 4 with image from Nissen et al., 2006
palatoquadrate cartilage aplastic/hypoplastic, abnormal Fig. 1 with image from Wang et al., 2013
palatoquadrate cartilage decreased size, abnormal Fig. 4 with image from Nissen et al., 2006
symplectic decreased size, abnormal Fig. 4 with image from Nissen et al., 2006

Phenotype of all Fish created by or utilizing MO1-dcaf7
Phenotype Fish Conditions Figures
palatoquadrate cartilage aplastic, abnormal dcaf7hi3812Tg/hi3812Tg + MO1-dcaf7 standard conditions Fig. 4 with image from Nissen et al., 2006
Meckel's cartilage aplastic, abnormal dcaf7hi3812Tg/hi3812Tg + MO1-dcaf7 standard conditions Fig. 4 with image from Nissen et al., 2006
ceratohyal cartilage aplastic, abnormal dcaf7hi3812Tg/hi3812Tg + MO1-dcaf7 standard conditions Fig. 4 with image from Nissen et al., 2006
symplectic decreased size, abnormal dcaf7hi3812Tg/hi3812Tg + MO1-dcaf7 standard conditions Fig. 4 with image from Nissen et al., 2006
metapterygoid morphology, abnormal dcaf7hi3812Tg/hi3812Tg + MO1-dcaf7 standard conditions Fig. 4 with image from Nissen et al., 2006
palatoquadrate cartilage decreased size, abnormal WT + MO1-dcaf7 standard conditions Fig. 4 with image from Nissen et al., 2006
determination of left/right asymmetry in lateral mesoderm process quality, abnormal WT + MO1-dcaf7 standard conditions Fig. 4Fig. 5 from Mazmanian et al., 2010
heart morphogenesis process quality, abnormal WT + MO1-dcaf7 standard conditions Fig. 4 from Mazmanian et al., 2010
determination of left/right asymmetry in diencephalon process quality, abnormal WT + MO1-dcaf7 standard conditions Fig. 4 from Mazmanian et al., 2010
palatoquadrate cartilage aplastic/hypoplastic, abnormal WT + MO1-dcaf7 standard conditions Fig. 1 with image from Wang et al., 2013
heart physical object quality, abnormal WT + MO1-dcaf7 standard conditions Fig. 4 from Mazmanian et al., 2010
Meckel's cartilage decreased size, abnormal WT + MO1-dcaf7 standard conditions Fig. 4 with image from Nissen et al., 2006
Meckel's cartilage aplastic/hypoplastic, abnormal WT + MO1-dcaf7 standard conditions Fig. 1 with image from Wang et al., 2013
embryonic viscerocranium morphogenesis process quality, abnormal WT + MO1-dcaf7 + MO2-dcaf7 heat shock Fig. 1 with image from Alvarado et al., 2016
cranial skeletal system development disrupted, abnormal WT + MO1-dcaf7 + MO2-dcaf7 heat shock Fig. 1 with image from Alvarado et al., 2016
cranial skeletal system development disrupted, abnormal WT + MO1-dcaf7 + MO2-dcaf7 standard conditions Fig. 1 with image from Alvarado et al., 2016
embryonic viscerocranium morphogenesis process quality, abnormal WT + MO1-dcaf7 + MO2-dcaf7 standard conditions Fig. 1 with image from Alvarado et al., 2016
mandibular arch skeleton morphology, abnormal WT + MO1-dcaf7 + MO2-dcaf7 standard conditions Fig. 1 with image from Alvarado et al., 2016
mandibular arch skeleton morphology, abnormal WT + MO1-dcaf7 + MO2-dcaf7 heat shock Fig. 1 with image from Alvarado et al., 2016
cranial skeletal system development process quality, ameliorated csu9Tg + MO1-dcaf7 + MO2-dcaf7 heat shock Fig. 1 with image from Alvarado et al., 2016
mandibular arch skeleton morphology, abnormal csu9Tg + MO1-dcaf7 + MO2-dcaf7 standard conditions Fig. 1 with image from Alvarado et al., 2016
cranial skeletal system development disrupted, abnormal csu9Tg + MO1-dcaf7 + MO2-dcaf7 standard conditions Fig. 1 with image from Alvarado et al., 2016
embryonic viscerocranium morphogenesis process quality, abnormal csu9Tg + MO1-dcaf7 + MO2-dcaf7 standard conditions Fig. 1 with image from Alvarado et al., 2016
mandibular arch skeleton morphology, ameliorated csu9Tg + MO1-dcaf7 + MO2-dcaf7 heat shock Fig. 1 with image from Alvarado et al., 2016
OTHER MO1-dcaf7 MORPHOLINO PAGESNo links to external sites
CITATIONS (4)