header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060407-2
Morpholino Name: MO1-etv2
Target: etv2 (1)
Previous Names: MO1-ets1b, etsrp atgMO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTGGTACATTTCCATATCTTAAAGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-etv2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-etv2
Expressed Gene Anatomy Figures
erg Fig. 3 with image from Ellett et al., 2009
gata1a Fig. 4 with image from Takeuchi et al., 2015
kdrl Fig. S3 from Liu et al., 2008
Fig. 3 from Xiong et al., 2008
npas4l Fig. 4 from Reischauer et al., 2016
spi1b Fig. 4 with image from Takeuchi et al., 2015
Fig. S3 from Liu et al., 2008
tal1 Fig. S3 from Liu et al., 2008
Fig. 4 from Xiong et al., 2008
PHENOTYPE
Phenotype resulting from MO1-etv2
No data available

Phenotype of all Fish created by or utilizing MO1-etv2
Phenotype Fish Conditions Figures
myeloid cell differentiation disrupted, abnormal WT + MO1-etv2 + MO2-etv2 standard conditions Fig. 2 from Sumanas et al., 2008
endothelial cell cdh5 expression absent, abnormal WT + MO1-etv2 + MO2-etv2 standard conditions Fig. 8 with image from Xie et al., 2016
endothelial cell absent, abnormal WT + MO1-etv2 + MO2-etv2 standard conditions Fig. 8 with image from Xie et al., 2016
intersegmental vessel sprouting angiogenesis decreased process quality, abnormal ci6Tg + MO1-etv2 + MO2-etv2 control Fig. 2 from Craig et al., 2015
blood vessel development disrupted, abnormal s843Tg + MO1-etv2 + MO2-etv2 standard conditions Fig. 3 with image from Chou et al., 2013
blood vasculature lacks parts or has fewer parts of type blood vessel, abnormal s843Tg + MO1-etv2 + MO2-etv2 standard conditions Fig. S5 from Reischauer et al., 2016
dorsal aorta absent, abnormal s843Tg + MO1-etv2 + MO2-etv2 standard conditions Fig. 3 with image from Chou et al., 2013
intersegmental vessel EGFP expression absent, abnormal s843Tg + MO1-etv2 + MO2-etv2 standard conditions Fig. S5 from Reischauer et al., 2016
caudal vein plexus EGFP expression decreased amount, abnormal s843Tg + MO1-etv2 + MO2-etv2 standard conditions Fig. S5 from Reischauer et al., 2016
vasculogenesis process quality, abnormal y1Tg + MO1-etv2 + MO2-etv2 control Fig. 3 from Craig et al., 2015
interrenal primordium bilateral, abnormal y1Tg + MO1-etv2 + MO2-etv2 standard conditions Fig. 2 with image from Chou et al., 2010
intersegmental vessel absent, abnormal y1Tg + MO1-etv2 + MO2-etv2 control Fig. 3 from Craig et al., 2015
dorsal aorta absent, abnormal y1Tg + MO1-etv2 + MO2-etv2 standard conditions Fig. 2 with image from Chou et al., 2010
interrenal primordium left side unfused from interrenal primordium right side, abnormal y1Tg + MO1-etv2 + MO2-etv2 standard conditions Fig. 2 with image from Chou et al., 2010
vascular endothelium mislocalised, abnormal y1Tg + MO1-etv2 + MO2-etv2 standard conditions Fig. 2 with image from Chou et al., 2010
dorsal aorta decreased size, abnormal y1Tg + MO1-etv2 + MO2-etv2 standard conditions Fig. 2 with image from Chou et al., 2010
posterior cardinal vein absent, abnormal y1Tg + MO1-etv2 + MO2-etv2 standard conditions Fig. 2 with image from Chou et al., 2010
axial vasculature apoptotic process increased process quality, abnormal y1Tg + MO1-etv2 + MO2-etv2 control Fig. 6 from Craig et al., 2015
intersegmental vessel spatial pattern, abnormal y1Tg + MO1-etv2 + MO2-etv2 control Fig. 3 from Craig et al., 2015
intestine decreased size, abnormal zf346Tg + MO1-etv2 + MO2-etv2 standard conditions Fig. 3 with image from Chou et al., 2013
dorsal aorta absent, abnormal zf346Tg + MO1-etv2 + MO2-etv2 standard conditions Fig. 3 with image from Chou et al., 2013
blood vessel development disrupted, abnormal zf346Tg + MO1-etv2 + MO2-etv2 standard conditions Fig. 3 with image from Chou et al., 2013
posterior lateral plate mesoderm gata1a expression amount, ameliorated kdm1ait627/it627 + MO1-etv2(AB/TL) standard conditions Fig. 4 with image from Takeuchi et al., 2015
intermediate cell mass of mesoderm gata1a expression amount, ameliorated kdm1ait627/it627 + MO1-etv2(AB/TL) standard conditions Fig. 4 with image from Takeuchi et al., 2015
intermediate cell mass of mesoderm spi1b expression mislocalised, abnormal AB/TL + MO1-etv2 + MO1-gata1a standard conditions Fig. 4 with image from Takeuchi et al., 2015
intermediate cell mass of mesoderm spi1b expression position, ameliorated kdm1ait627/it627 + MO1-etv2 + MO1-gata1a(AB/TL) standard conditions Fig. 4 with image from Takeuchi et al., 2015
endothelial cell absent, abnormal WT + MO1-etv2 + MO1-gna13a + MO1-gna13b + MO2-etv2 standard conditions Fig. 8 with image from Xie et al., 2016
myocardial precursor cardioblast migration to the midline involved in heart field formation occurrence, ameliorated WT + MO1-etv2 + MO1-gna13a + MO1-gna13b + MO2-etv2 standard conditions Fig. 8 with image from Xie et al., 2016
endothelial cell cdh5 expression absent, abnormal WT + MO1-etv2 + MO1-gna13a + MO1-gna13b + MO2-etv2 standard conditions Fig. 8 with image from Xie et al., 2016
myocardium fused with myocardium, ameliorated WT + MO1-etv2 + MO1-gna13a + MO1-gna13b + MO2-etv2 standard conditions Fig. 8 with image from Xie et al., 2016
blood vasculature disorganized, abnormal y1Tg + MO1-erg + MO1-etv2 standard conditions Fig. 4 with image from Ellett et al., 2009
angiogenesis disrupted, abnormal y1Tg + MO1-erg + MO1-etv2 standard conditions Fig. 4 with image from Ellett et al., 2009
dorsal longitudinal anastomotic vessel hypoplastic, abnormal y1Tg + MO1-erg + MO1-etv2 standard conditions Fig. 4 with image from Ellett et al., 2009
intersegmental vessel hypoplastic, abnormal y1Tg + MO1-erg + MO1-etv2 standard conditions Fig. 4 with image from Ellett et al., 2009
intersegmental vessel sprouting angiogenesis arrested, abnormal fli1btpl50Gt/+; y1Tg + MO1-etv2 + MO2-etv2 control Fig. 3 from Craig et al., 2015
intersegmental vessel absent, abnormal fli1btpl50Gt/+; y1Tg + MO1-etv2 + MO2-etv2 control Fig. 3 from Craig et al., 2015
vasculogenesis process quality, abnormal fli1btpl50Gt/+; y1Tg + MO1-etv2 + MO2-etv2 control Fig. 3 from Craig et al., 2015
axial vasculature apoptotic process increased process quality, abnormal fli1btpl50Gt/tpl50Gt; y1Tg + MO1-etv2 + MO2-etv2 control Fig. 6 from Craig et al., 2015
intersegmental vessel sprouting angiogenesis arrested, abnormal fli1btpl50Gt/tpl50Gt; y1Tg + MO1-etv2 + MO2-etv2 control Fig. 3 from Craig et al., 2015
axial vasculature malformed, abnormal fli1btpl50Gt/tpl50Gt; y1Tg + MO1-etv2 + MO2-etv2 control Fig. 3 from Craig et al., 2015
axial vasculature vasculogenesis process quality, abnormal fli1btpl50Gt/tpl50Gt; y1Tg + MO1-etv2 + MO2-etv2 control Fig. 3 from Craig et al., 2015
intersegmental vessel absent, abnormal fli1btpl50Gt/tpl50Gt; y1Tg + MO1-etv2 + MO2-etv2 control Fig. 3 from Craig et al., 2015
vasculogenesis process quality, abnormal fli1btpl50Gt/tpl50Gt; y1Tg + MO1-etv2 + MO2-etv2 control Fig. 3 from Craig et al., 2015
endothelial cell absent, abnormal fb9Tg ; y1Tg + MO1-etv2 + MO1-gna13a + MO1-gna13b + MO2-etv2 standard conditions Fig. 8 with image from Xie et al., 2016
endothelial cell EGFP expression absent, abnormal fb9Tg ; y1Tg + MO1-etv2 + MO1-gna13a + MO1-gna13b + MO2-etv2 standard conditions Fig. 8 with image from Xie et al., 2016
myocardial precursor cardioblast migration to the midline involved in heart field formation occurrence, ameliorated fb9Tg ; y1Tg + MO1-etv2 + MO1-gna13a + MO1-gna13b + MO2-etv2 standard conditions Fig. 8 with image from Xie et al., 2016
Genome Resources:
CITATIONS (22)