Morpholino

MO1-etsrp

ID
ZDB-MRPHLNO-060407-2
Name
MO1-etsrp
Previous Names
  • MO1-ets1b
  • MO1-etv2
  • etsrp atgMO (1)
Target
Sequence
5' - TTGGTACATTTCCATATCTTAAAGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-etsrp
Phenotype
Phenotype resulting from MO1-etsrp
No data available
Phenotype of all Fish created by or utilizing MO1-etsrp
Phenotype Fish Conditions Figures
myeloid cell differentiation disrupted, abnormal WT + MO1-etsrp + MO2-etsrp standard conditions Fig. 2 from Sumanas et al., 2008
endothelial cell cdh5 expression absent, abnormal WT + MO1-etsrp + MO2-etsrp standard conditions Fig. 8 with image from Xie et al., 2016
endothelial cell absent, abnormal WT + MO1-etsrp + MO2-etsrp standard conditions Fig. 8 with image from Xie et al., 2016
intersegmental vessel sprouting angiogenesis decreased process quality, abnormal ci6Tg + MO1-etsrp + MO2-etsrp control Fig. 2 from Craig et al., 2015
blood vessel development disrupted, abnormal s843Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 3 with image from Chou et al., 2013
blood vasculature lacks parts or has fewer parts of type blood vessel, abnormal s843Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. S5 from Reischauer et al., 2016
dorsal aorta absent, abnormal s843Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 3 with image from Chou et al., 2013
intersegmental vessel EGFP expression absent, abnormal s843Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. S5 from Reischauer et al., 2016
caudal vein plexus EGFP expression decreased amount, abnormal s843Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. S5 from Reischauer et al., 2016
vasculogenesis process quality, abnormal y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
interrenal primordium bilateral, abnormal y1Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 2 with image from Chou et al., 2010
intersegmental vessel absent, abnormal y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
dorsal aorta absent, abnormal y1Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 2 with image from Chou et al., 2010
interrenal primordium left side unfused from interrenal primordium right side, abnormal y1Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 2 with image from Chou et al., 2010
vascular endothelium mislocalised, abnormal y1Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 2 with image from Chou et al., 2010
dorsal aorta decreased size, abnormal y1Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 2 with image from Chou et al., 2010
posterior cardinal vein absent, abnormal y1Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 2 with image from Chou et al., 2010
axial vasculature apoptotic process increased process quality, abnormal y1Tg + MO1-etsrp + MO2-etsrp control Fig. 6 from Craig et al., 2015
intersegmental vessel spatial pattern, abnormal y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
intestine decreased size, abnormal zf346Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 3 with image from Chou et al., 2013
dorsal aorta absent, abnormal zf346Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 3 with image from Chou et al., 2013
blood vessel development disrupted, abnormal zf346Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 3 with image from Chou et al., 2013
posterior lateral plate mesoderm gata1a expression amount, ameliorated kdm1ait627/it627 + MO1-etv2 standard conditions Fig. 4 with image from Takeuchi et al., 2015
intermediate cell mass of mesoderm gata1a expression amount, ameliorated kdm1ait627/it627 + MO1-etv2 standard conditions Fig. 4 with image from Takeuchi et al., 2015
intermediate cell mass of mesoderm spi1b expression mislocalised, abnormal AB/TL + MO1-etv2 + MO1-gata1a standard conditions Fig. 4 with image from Takeuchi et al., 2015
intermediate cell mass of mesoderm spi1b expression position, ameliorated kdm1ait627/it627 + MO1-etv2 + MO1-gata1a standard conditions Fig. 4 with image from Takeuchi et al., 2015
endothelial cell absent, abnormal WT + MO1-etsrp + MO1-gna13a + MO1-gna13b + MO2-etsrp standard conditions Fig. 8 with image from Xie et al., 2016
myocardial precursor cardioblast migration to the midline involved in heart field formation occurrence, ameliorated WT + MO1-etsrp + MO1-gna13a + MO1-gna13b + MO2-etsrp standard conditions Fig. 8 with image from Xie et al., 2016
endothelial cell cdh5 expression absent, abnormal WT + MO1-etsrp + MO1-gna13a + MO1-gna13b + MO2-etsrp standard conditions Fig. 8 with image from Xie et al., 2016
myocardium fused with myocardium, ameliorated WT + MO1-etsrp + MO1-gna13a + MO1-gna13b + MO2-etsrp standard conditions Fig. 8 with image from Xie et al., 2016
blood vasculature disorganized, abnormal y1Tg + MO1-erg + MO1-etv2 standard conditions Fig. 4 with image from Ellett et al., 2009
dorsal longitudinal anastomotic vessel hypoplastic, abnormal y1Tg + MO1-erg + MO1-etv2 standard conditions Fig. 4 with image from Ellett et al., 2009
angiogenesis disrupted, abnormal y1Tg + MO1-erg + MO1-etv2 standard conditions Fig. 4 with image from Ellett et al., 2009
intersegmental vessel hypoplastic, abnormal y1Tg + MO1-erg + MO1-etv2 standard conditions Fig. 4 with image from Ellett et al., 2009
intersegmental vessel sprouting angiogenesis arrested, abnormal fli1btpl50Gt/+; y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
intersegmental vessel absent, abnormal fli1btpl50Gt/+; y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
vasculogenesis process quality, abnormal fli1btpl50Gt/+; y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
axial vasculature apoptotic process increased process quality, abnormal fli1btpl50Gt/tpl50Gt; y1Tg + MO1-etsrp + MO2-etsrp control Fig. 6 from Craig et al., 2015
intersegmental vessel sprouting angiogenesis arrested, abnormal fli1btpl50Gt/tpl50Gt; y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
axial vasculature malformed, abnormal fli1btpl50Gt/tpl50Gt; y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
axial vasculature vasculogenesis process quality, abnormal fli1btpl50Gt/tpl50Gt; y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
intersegmental vessel absent, abnormal fli1btpl50Gt/tpl50Gt; y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
vasculogenesis process quality, abnormal fli1btpl50Gt/tpl50Gt; y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
endothelial cell absent, abnormal fb9Tg ; y1Tg + MO1-etsrp + MO1-gna13a + MO1-gna13b + MO2-etsrp standard conditions Fig. 8 with image from Xie et al., 2016
endothelial cell EGFP expression absent, abnormal fb9Tg ; y1Tg + MO1-etsrp + MO1-gna13a + MO1-gna13b + MO2-etsrp standard conditions Fig. 8 with image from Xie et al., 2016
myocardial precursor cardioblast migration to the midline involved in heart field formation occurrence, ameliorated fb9Tg ; y1Tg + MO1-etsrp + MO1-gna13a + MO1-gna13b + MO2-etsrp standard conditions Fig. 8 with image from Xie et al., 2016
Citations