Morpholino

MO3-csf3r

ID
ZDB-MRPHLNO-111213-1
Name
MO3-csf3r
Previous Names
None
Target
Sequence
5' - GAAGCACAAGCGAGACGGATGCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-csf3r
No data available
Phenotype
Phenotype resulting from MO3-csf3r
Phenotype of all Fish created by or utilizing MO3-csf3r
Phenotype Fish Conditions Figures
whole organism decreased life span, abnormal AB + MO3-csf3r bacterial treatment by injection: Burkholderia cenocepacia Fig. 4 from Mesureur et al., 2017
neutrophil decreased amount, abnormal AB + MO3-csf3r control Fig. 3 with image from Ellett et al., 2018
whole organism decreased life span, abnormal AB + MO3-csf3r fungal treatment by injection: Talaromyces marneffei Fig. 3 with image from Ellett et al., 2018
neutrophil increased amount, ameliorated AB + MO3-csf3r fungal treatment by injection: Talaromyces marneffei Fig. 3 with image from Ellett et al., 2018
whole organism has fewer parts of type neutrophil, abnormal TU + MO3-csf3r bacterial treatment by injection: Acinetobacter baumannii ATCC 17978 Fig. S2 with image from Bhuiyan et al., 2016
response to bacterium decreased process quality, abnormal WT + MO3-csf3r bacterial treatment by injection: Mycobacteroides abscessus Fig. 5 with image from Bernut et al., 2016
response to virus process quality, abnormal WT + MO3-csf3r viral treatment: Chikungunya virus Fig. 7 with image from Palha et al., 2013
whole organism decreased life span, abnormal WT + MO3-csf3r bacterial treatment by injection: Mycobacteroides abscessus Fig. 5 with image from Bernut et al., 2016
granuloma formation decreased occurrence, abnormal WT + MO3-csf3r bacterial treatment by injection: Mycobacteroides abscessus Fig. 8 with image from Bernut et al., 2016
whole organism decreased life span, abnormal WT + MO3-csf3r viral treatment: Chikungunya virus Fig. 7 with image from Palha et al., 2013
macrophage increased amount, abnormal gl22Tg + MO3-csf3r standard conditions Fig. S1 with image from Yan et al., 2015
neutrophil decreased amount, abnormal nz50Tg + MO3-csf3r chemical treatment: prostaglandin E2 Fig. S4 with image from Feng et al., 2012
liver neutrophil decreased amount, abnormal nz50Tg + MO3-csf3r chemical treatment: doxycycline monohydrate Fig. 3 with image from Yan et al., 2015
neutrophil differentiation disrupted, abnormal nz50Tg + MO3-csf3r chemical treatment: prostaglandin E2 Fig. S4 with image from Feng et al., 2012
macrophage decreased amount, abnormal nz50Tg + MO3-csf3r standard conditions Fig. S4 with image from Feng et al., 2012
neutrophil decreased amount, abnormal nz50Tg + MO3-csf3r standard conditions Fig. 6 with image from Huo et al., 2019
Fig. S1 with image from Yan et al., 2015
Fig. S3 with imageFig. S4 with image from Feng et al., 2012
macrophage decreased amount, abnormal nz50Tg + MO3-csf3r chemical treatment: prostaglandin E2 Fig. S4 with image from Feng et al., 2012
neutrophil differentiation disrupted, abnormal nz50Tg + MO3-csf3r standard conditions Fig. S4 with image from Feng et al., 2012
neutrophil decreased amount, abnormal gl23Tg; i113Tg + MO3-csf3r control Fig. 5 with image from Ellett et al., 2018
liver hematopoietic multipotent progenitor cell ab1-tgfb1a labeling amount, ameliorated gz32Tg/gz32Tg + MO3-csf3r chemical treatment by environment: doxycycline Fig. 2 with image from Yang et al., 2018
liver hematopoietic multipotent progenitor cell Ab5-acta2 labeling increased amount, abnormal gz32Tg/gz32Tg + MO3-csf3r chemical treatment by environment: doxycycline, chemical treatment by environment: lipopolysaccharide Fig. 2 with image from Yang et al., 2018
liver hematopoietic multipotent progenitor cell Ab5-acta2 labeling increased amount, abnormal gz32Tg/gz32Tg + MO3-csf3r chemical treatment by environment: doxycycline Fig. 2 with image from Yang et al., 2018
hematopoietic multipotent progenitor cell apoptotic process increased occurrence, abnormal gz32Tg/gz32Tg + MO3-csf3r chemical treatment by environment: doxycycline Fig. 2 with image from Yang et al., 2018
liver hematopoietic multipotent progenitor cell Ab14-gfap labeling increased amount, abnormal gz32Tg/gz32Tg + MO3-csf3r chemical treatment by environment: doxycycline Fig. 2 with image from Yang et al., 2018
hematopoietic multipotent progenitor cell apoptotic process increased occurrence, abnormal gz32Tg/gz32Tg + MO3-csf3r chemical treatment by environment: doxycycline, chemical treatment by environment: lipopolysaccharide Fig. 2 with image from Yang et al., 2018
liver hematopoietic multipotent progenitor cell ab1-casp3 labeling amount, ameliorated gz32Tg/gz32Tg + MO3-csf3r chemical treatment by environment: doxycycline, chemical treatment by environment: lipopolysaccharide Fig. 2 with image from Yang et al., 2018
liver hematopoietic multipotent progenitor cell Ab14-gfap labeling increased amount, abnormal gz32Tg/gz32Tg + MO3-csf3r chemical treatment by environment: doxycycline, chemical treatment by environment: lipopolysaccharide Fig. 2 with image from Yang et al., 2018
regulation of hydrogen peroxide metabolic process disrupted, abnormal WT + MO1-spi1b + MO3-csf3r standard conditions Fig. 1 with image from Pase et al., 2012
caudal fin fin regeneration decreased occurrence, ameliorated WT + MO3-csf3r + MO7-cftr amputation: caudal fin Figure 4 with image from Bernut et al., 2020
macrophage decreased amount, abnormal gl23Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. S4 with image from Gauert et al., 2020
liver size, ameliorated gz32Tg + MO3-csf3r chemical treatment: doxycycline Fig. 3 from Yan et al., 2017
macrophage differentiation disrupted, abnormal nz50Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. S4 with image from Feng et al., 2012
neutrophil decreased amount, abnormal nz50Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. S3 with imageFig. S4 with image from Feng et al., 2012
neutrophil differentiation disrupted, abnormal nz50Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. S4 with image from Feng et al., 2012
macrophage decreased amount, abnormal nz50Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. S4 with image from Feng et al., 2012
macrophage decreased amount, abnormal nz50Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. S4 with image from Feng et al., 2012
neutrophil differentiation disrupted, abnormal nz50Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. S4 with image from Feng et al., 2012
neutrophil decreased amount, abnormal nz50Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. S4 with image from Feng et al., 2012
macrophage differentiation disrupted, abnormal nz50Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. S4 with image from Feng et al., 2012
muscle cell cell wall repair process quality, abnormal gl22Tg + MO1-irf8 + MO1-spi1b + MO3-csf3r light damage: sarcolemma: muscle cell Fig. 1 with image from Middel et al., 2016
macrophage absent, abnormal gl22Tg + MO1-irf8 + MO1-spi1b + MO3-csf3r light damage: sarcolemma: muscle cell Fig. 1 with image from Middel et al., 2016
liver size, ameliorated gz32Tg + MO1-spi1b + MO3-csf3r chemical treatment: doxycycline Fig. 3 from Yan et al., 2017
liver macrophage increased amount, abnormal gl22Tg; gz32Tg + MO3-csf3r chemical treatment: doxycycline Fig. 3 from Yan et al., 2017
neutrophil decreased amount, abnormal gl23Tg; i113Tg + MO1-spi1b + MO3-csf3r control Fig. 5 with image from Ellett et al., 2018
defense response to fungus increased efficacy, abnormal gl23Tg; i113Tg + MO1-spi1b + MO3-csf3r fungal treatment by injection: Talaromyces marneffei Fig. 5 with image from Ellett et al., 2018
macrophage decreased amount, abnormal gl23Tg; i113Tg + MO1-spi1b + MO3-csf3r control Fig. 5 with image from Ellett et al., 2018
neutrophil decreased amount, abnormal gl23Tg; i114Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. S4 with image from Gauert et al., 2020
macrophage decreased amount, abnormal gl23Tg; i114Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. S4 with image from Gauert et al., 2020
liver neutrophil amount, ameliorated gz26Tg; rj30Tg + MO3-csf3r chemical treatment by environment: doxycycline Fig. 5 with image from Zhao et al., 2016
liver size, ameliorated gz26Tg; rj30Tg + MO3-csf3r chemical treatment by environment: doxycycline Fig. 5 with image from Zhao et al., 2016
liver neutrophil amount, ameliorated gz32Tg; nz50Tg + MO3-csf3r chemical treatment: doxycycline Fig. 3 from Yan et al., 2017
liver anatomical region has extra parts of type blood vessel, ameliorated gz37Tg; zf497Tg + MO3-csf3r chemical treatment: doxycycline Fig. 6 with image from Huo et al., 2019
liver size, ameliorated gz37Tg; zf497Tg + MO3-csf3r chemical treatment: doxycycline Fig. 6 with image from Huo et al., 2019
mucus secreting cell proliferative, abnormal hzm1Et; io006Tg + MO3-csf3r chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
mucus secreting cell decreased amount, abnormal hzm1Et; io006Tg + MO3-csf3r chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
neutrophil decreased amount, abnormal hzm1Et; io006Tg + MO3-csf3r chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
mucus secreting cell decreased amount, abnormal hzm1Et; io006Tg + MO3-csf3r standard conditions Fig. 3 with image from Feng et al., 2012
mucus secreting cell proliferative, abnormal hzm1Et; io006Tg + MO3-csf3r standard conditions Fig. 3 with image from Feng et al., 2012
neutrophil decreased amount, abnormal hzm1Et; io006Tg + MO3-csf3r standard conditions Fig. 3 with image from Feng et al., 2012
neutrophil absent, abnormal hzm1Et; io006Tg; nz50Tg + MO3-csf3r control Fig. 3 with image from Antonio et al., 2015
neutrophil absent, abnormal hzm1Et; io006Tg; nz50Tg + MO3-csf3r resection: caudal fin Fig. 3 with image from Antonio et al., 2015
liver macrophage amount, ameliorated gl22Tg; gz32Tg + MO1-spi1b + MO3-csf3r chemical treatment: doxycycline Fig. 3 from Yan et al., 2017
liver neutrophil amount, ameliorated gz32Tg; nz50Tg + MO1-spi1b + MO3-csf3r chemical treatment: doxycycline Fig. 3 from Yan et al., 2017
mucus secreting cell decreased amount, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. 3 with image from Feng et al., 2012
notochord epithelium accumulation neutrophil, ameliorated hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. 4. with image from López-Cuevas et al., 2021
neutrophil decreased amount, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. 3 with image from Feng et al., 2012
notochord epithelium accumulation macrophage, ameliorated hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. 4. with image from López-Cuevas et al., 2021
macrophage decreased amount, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. 3 with image from Feng et al., 2012
macrophage decreased amount, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
mucus secreting cell proliferative, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
neutrophil decreased amount, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
mucus secreting cell decreased amount, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
mucus secreting cell proliferative, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. 3 with image from Feng et al., 2012
notochord cell population proliferation occurrence, ameliorated hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. 4. with image from López-Cuevas et al., 2021
macrophage absent, abnormal hzm1Et; io006Tg; nz50Tg + MO1-spi1b + MO3-csf3r control Fig. 3 with image from Antonio et al., 2015
macrophage absent, abnormal hzm1Et; io006Tg; nz50Tg + MO1-spi1b + MO3-csf3r resection: caudal fin Fig. 3 with image from Antonio et al., 2015
neutrophil absent, abnormal hzm1Et; io006Tg; nz50Tg + MO1-spi1b + MO3-csf3r control Fig. 3 with image from Antonio et al., 2015
neutrophil absent, abnormal hzm1Et; io006Tg; nz50Tg + MO1-spi1b + MO3-csf3r resection: caudal fin Fig. 3 with image from Antonio et al., 2015
Citations