Morpholino
MO3-csf3r
- ID
- ZDB-MRPHLNO-111213-1
- Name
- MO3-csf3r
- Previous Names
- None
- Target
- Sequence
-
5' - GAAGCACAAGCGAGACGGATGCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-csf3r
No data available
Phenotype
Phenotype resulting from MO3-csf3r
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO3-csf3r
1 - 5 of 70 Show all
Citations
- Ellett, F., Kacamak, N.I., Alvarez, C.R., Oliveira, E.H.S., Hasturk, H., Paster, B.J., Kantarci, A., Irimia, D. (2023) Fusobacterium nucleatum dissemination by neutrophils. Journal of oral microbiology. 15:22170672217067
- López-Cuevas, P., Deane, L., Yang, Y., Hammond, C.L., Kague, E. (2021) Transformed notochordal cells trigger chronic wounds destabilizing the vertebral column and bone homeostasis. Disease models & mechanisms. 14(3):
- Okuda, K.S., Keyser, M.S., Gurevich, D.B., Sturtzel, C., Mason, E.A., Paterson, S., Chen, H., Scott, M., Condon, N.D., Martin, P., Distel, M., Hogan, B.M. (2021) Live-imaging of endothelial Erk activity reveals dynamic and sequential signalling events during regenerative angiogenesis. eLIFE. 10:
- Bernut, A., Loynes, C.A., Floto, R.A., Renshaw, S.A. (2020) Deletion of cftr Leads to an Excessive Neutrophilic Response and Defective Tissue Repair in a Zebrafish Model of Sterile Inflammation. Frontiers in immunology. 11:1733
- Gauert, A., Olk, N., Pimentel-Gutiérrez, H., Astrahantseff, K., Jensen, L.D., Cao, Y., Eggert, A., Eckert, C., Hagemann, A.I.H. (2020) Fast, In Vivo Model for Drug-Response Prediction in Patients with B-Cell Precursor Acute Lymphoblastic Leukemia. Cancers. 12(7)
- Klems, A., van Rijssel, J., Ramms, A.S., Wild, R., Hammer, J., Merkel, M., Derenbach, L., Préau, L., Hinkel, R., Suarez-Martinez, I., Schulte-Merker, S., Vidal, R., Sauer, S., Kivelä, R., Alitalo, K., Kupatt, C., van Buul, J.D., le Noble, F. (2020) The GEF Trio controls endothelial cell size and arterial remodeling downstream of Vegf signaling in both zebrafish and cell models. Nature communications. 11:5319
- Huo, X., Li, H., Li, Z., Yan, C., Agrawal, I., Mathavan, S., Liu, J., Gong, Z. (2019) Transcriptomic profiles of tumor-associated neutrophils reveal prominent roles in enhancing angiogenesis in liver tumorigenesis in zebrafish. Scientific Reports. 9:1509
- Ellett, F., Pazhakh, V., Pase, L., Benard, E.L., Weerasinghe, H., Azabdaftari, D., Alasmari, S., Andrianopoulos, A., Lieschke, G.J. (2018) Macrophages protect Talaromyces marneffei conidia from myeloperoxidase-dependent neutrophil fungicidal activity during infection establishment in vivo. PLoS pathogens. 14:e1007063
- Phan, Q.T., Sipka, T., Gonzalez, C., Levraud, J.P., Lutfalla, G., Nguyen-Chi, M. (2018) Neutrophils use superoxide to control bacterial infection at a distance. PLoS pathogens. 14:e1007157
- Yang, Q., Yan, C., Gong, Z. (2018) Interaction of hepatic stellate cells with neutrophils and macrophages in the liver following oncogenic kras activation in transgenic zebrafish. Scientific Reports. 8:8495
1 - 10 of 23
Show