Morpholino

MO2-mnx1

ID
ZDB-MRPHLNO-111028-2
Name
MO2-mnx1
Previous Names
None
Target
Sequence
5' - TTTTTAGATTTCTCCATCTGGCCCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO targeted to translational start site of mnx1.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-mnx1
Expressed Gene Anatomy Figures
arxa Fig. S6 with image from Dalgin et al., 2011
gcga Fig. 4 with image,  Fig. 7 with image from Dalgin et al., 2011
ins Fig. 4 with image,  Fig. 5 with image,  Fig. 7 with image,  Fig. 8 with image from Dalgin et al., 2011
Fig. 1 with image from Kimmel et al., 2011
myod1 Fig. 3 with image from Dalgin et al., 2011
neurod1 Fig. 3 with image from Dalgin et al., 2011
sst1.1 Fig. 4 with image from Dalgin et al., 2011
Phenotype
Phenotype resulting from MO2-mnx1
Phenotype Fish Figures
endocrine pancreas has extra parts of type pancreatic A cell, abnormal os26Tg + MO2-mnx1 Fig. 5 with image,  Fig. 8 with image from Dalgin et al., 2011
endocrine pancreas has fewer parts of type pancreatic B cell, abnormal nl1Tg + MO2-mnx1 Fig. 5 with image,  Fig. 8 with image from Dalgin et al., 2011
endocrine pancreas development disrupted, abnormal WT + MO2-mnx1 Fig. 1 with image,  Fig. 3 with image from Kimmel et al., 2011
extrapancreatic duct endocrine cell decreased amount, abnormal nl1Tg + MO2-mnx1 Fig. 5 with image from Kimmel et al., 2011
pancreatic A cell differentiation increased occurrence, abnormal AB + MO2-mnx1 Fig. 4 with image,  Fig. 7 with image,  Fig. 8 with image,  Fig. S6 with image from Dalgin et al., 2011
pancreatic B cell decreased amount, abnormal m1018Tg; nl1Tg + MO2-mnx1 Fig. 1 with image,  Fig. 3 with image from Kimmel et al., 2011
posterior pancreatic bud decreased size, abnormal WT + MO2-mnx1 Fig. 1 with image from Kimmel et al., 2011
posterior pancreatic bud has extra parts of type pancreatic A cell, abnormal AB + MO2-mnx1 Fig. 4 with image,  Fig. 7 with image,  Fig. S6 with image from Dalgin et al., 2011
posterior pancreatic bud has fewer parts of type pancreatic B cell, abnormal AB + MO2-mnx1 Fig. 4 with image,  Fig. 7 with image from Dalgin et al., 2011
type B pancreatic cell differentiation decreased occurrence, abnormal AB + MO2-mnx1 Fig. 4 with image,  Fig. 7 with image,  Fig. 8 with image from Dalgin et al., 2011
type B pancreatic cell differentiation disrupted, abnormal m1018Tg; nl1Tg + MO2-mnx1 Fig. 3 with image from Kimmel et al., 2011
type B pancreatic cell proliferation disrupted, abnormal m1018Tg; nl1Tg + MO2-mnx1 Fig. 3 with image from Kimmel et al., 2011
Phenotype of all Fish created by or utilizing MO2-mnx1
Phenotype Fish Conditions Figures
posterior pancreatic bud has fewer parts of type pancreatic B cell, abnormal AB + MO2-mnx1 chemical treatment: all-trans-retinoic acid Fig. 7 with image from Dalgin et al., 2011
posterior pancreatic bud has fewer parts of type pancreatic B cell, abnormal AB + MO2-mnx1 standard conditions Fig. 4 with image,  Fig. 7 with image from Dalgin et al., 2011
pancreatic A cell differentiation increased occurrence, abnormal AB + MO2-mnx1 chemical treatment: all-trans-retinoic acid Fig. 7 with image from Dalgin et al., 2011
posterior pancreatic bud has extra parts of type pancreatic A cell, abnormal AB + MO2-mnx1 chemical treatment: all-trans-retinoic acid Fig. 7 with image from Dalgin et al., 2011
endocrine pancreas development increased process quality, abnormal AB + MO2-mnx1 chemical treatment: all-trans-retinoic acid Fig. 7 with image from Dalgin et al., 2011
type B pancreatic cell differentiation decreased occurrence, abnormal AB + MO2-mnx1 standard conditions Fig. 4 with image,  Fig. 7 with image from Dalgin et al., 2011
retinoic acid receptor signaling pathway increased occurrence, abnormal AB + MO2-mnx1 chemical treatment: all-trans-retinoic acid Fig. 7 with image from Dalgin et al., 2011
type B pancreatic cell differentiation decreased occurrence, abnormal AB + MO2-mnx1 chemical treatment: all-trans-retinoic acid Fig. 7 with image from Dalgin et al., 2011
posterior pancreatic bud has extra parts of type pancreatic A cell, abnormal AB + MO2-mnx1 standard conditions Fig. 4 with image,  Fig. 7 with image,  Fig. S6 with image from Dalgin et al., 2011
pancreatic A cell differentiation increased occurrence, abnormal AB + MO2-mnx1 standard conditions Fig. 4 with image,  Fig. 7 with image,  Fig. S6 with image from Dalgin et al., 2011
posterior pancreatic bud decreased size, abnormal WT + MO2-mnx1 standard conditions Fig. 1 with image from Kimmel et al., 2011
pancreatic B cell decreased amount, abnormal WT + MO2-mnx1 standard conditions Fig. 1 with image from Kimmel et al., 2011
endocrine pancreas development disrupted, abnormal WT + MO2-mnx1 standard conditions Fig. 1 with image from Kimmel et al., 2011
pancreas posterior region has extra parts of type endocrine cell, abnormal nl1Tg + MO2-mnx1 chemical treatment: DAPT Fig. 6 with image from Kimmel et al., 2011
endocrine pancreas has extra parts of type pancreatic A cell, abnormal nl1Tg + MO2-mnx1 standard conditions Fig. 5 with image from Dalgin et al., 2011
extrapancreatic duct endocrine cell decreased amount, abnormal nl1Tg + MO2-mnx1 standard conditions Fig. 5 with image from Kimmel et al., 2011
endocrine pancreas has fewer parts of type pancreatic B cell, abnormal nl1Tg + MO2-mnx1 standard conditions Fig. 5 with image from Dalgin et al., 2011
pancreatic A cell differentiation increased occurrence, abnormal os26Tg + MO2-mnx1 standard conditions Fig. 8 with image from Dalgin et al., 2011
endocrine pancreas has extra parts of type pancreatic A cell, abnormal os26Tg + MO2-mnx1 standard conditions Fig. 8 with image from Dalgin et al., 2011
type B pancreatic cell differentiation decreased occurrence, abnormal os26Tg + MO2-mnx1 standard conditions Fig. 8 with image from Dalgin et al., 2011
endocrine pancreas has fewer parts of type pancreatic B cell, abnormal os26Tg + MO2-mnx1 standard conditions Fig. 8 with image from Dalgin et al., 2011
pancreatic B cell decreased amount, abnormal m1018Tg; nl1Tg + MO2-mnx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
type B pancreatic cell proliferation disrupted, abnormal m1018Tg; nl1Tg + MO2-mnx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
endocrine pancreas development disrupted, abnormal m1018Tg; nl1Tg + MO2-mnx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
type B pancreatic cell differentiation disrupted, abnormal m1018Tg; nl1Tg + MO2-mnx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
endocrine pancreas development disrupted, abnormal WT + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 1 with image from Kimmel et al., 2011
pancreatic B cell absent, abnormal WT + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 1 with image from Kimmel et al., 2011
endocrine pancreas development disrupted, abnormal nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 2 with image from Kimmel et al., 2011
posterior pancreatic bud elongated, abnormal nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 2 with image from Kimmel et al., 2011
posterior pancreatic bud cellular motility, abnormal nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 2 with image from Kimmel et al., 2011
type B pancreatic cell differentiation absent, abnormal m1018Tg; nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 2 with image from Kimmel et al., 2011
endocrine pancreas has fewer parts of type endodermal cell, abnormal m1018Tg; nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
type B pancreatic cell proliferation disrupted, abnormal m1018Tg; nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
endocrine pancreas development disrupted, abnormal m1018Tg; nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 2 with image from Kimmel et al., 2011
type B pancreatic cell differentiation disrupted, abnormal m1018Tg; nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
pancreatic B cell absent, abnormal m1018Tg; nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 2 with image,  Fig. 3 with image from Kimmel et al., 2011
endocrine pancreas decreased size, abnormal m1018Tg; nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.