Morpholino

MO2-mnx1

ID
ZDB-MRPHLNO-111028-2
Name
MO2-mnx1
Previous Names
None
Target
Sequence
5' - TTTTTAGATTTCTCCATCTGGCCCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO targeted to translational start site of mnx1.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-mnx1
No data available
Phenotype
Phenotype resulting from MO2-mnx1
Phenotype Fish Figures
endocrine pancreas has extra parts of type pancreatic A cell, abnormal nl1Tg + MO2-mnx1 Fig. 5 with imageFig. 8 with image from Dalgin et al., 2011
endocrine pancreas has fewer parts of type pancreatic B cell, abnormal nl1Tg + MO2-mnx1 Fig. 5 with imageFig. 8 with image from Dalgin et al., 2011
endocrine pancreas development disrupted, abnormal m1018Tg; nl1Tg + MO2-mnx1 Fig. 1 with imageFig. 3 with image from Kimmel et al., 2011
extrapancreatic duct endocrine cell decreased amount, abnormal nl1Tg + MO2-mnx1 Fig. 5 with image from Kimmel et al., 2011
pancreatic A cell differentiation increased occurrence, abnormal os26Tg + MO2-mnx1 Fig. 4 with imageFig. 7 with imageFig. 8 with imageFig. S6 with image from Dalgin et al., 2011
pancreatic B cell decreased amount, abnormal WT + MO2-mnx1 Fig. 1 with imageFig. 3 with image from Kimmel et al., 2011
posterior pancreatic bud decreased size, abnormal WT + MO2-mnx1 Fig. 1 with image from Kimmel et al., 2011
posterior pancreatic bud has extra parts of type pancreatic A cell, abnormal AB + MO2-mnx1 Fig. 4 with imageFig. 7 with imageFig. S6 with image from Dalgin et al., 2011
posterior pancreatic bud has fewer parts of type pancreatic B cell, abnormal AB + MO2-mnx1 Fig. 4 with imageFig. 7 with image from Dalgin et al., 2011
type B pancreatic cell differentiation decreased occurrence, abnormal AB + MO2-mnx1 Fig. 4 with imageFig. 7 with imageFig. 8 with image from Dalgin et al., 2011
type B pancreatic cell differentiation disrupted, abnormal m1018Tg; nl1Tg + MO2-mnx1 Fig. 3 with image from Kimmel et al., 2011
type B pancreatic cell proliferation disrupted, abnormal m1018Tg; nl1Tg + MO2-mnx1 Fig. 3 with image from Kimmel et al., 2011
Phenotype of all Fish created by or utilizing MO2-mnx1
Phenotype Fish Conditions Figures
posterior pancreatic bud has fewer parts of type pancreatic B cell, abnormal AB + MO2-mnx1 chemical treatment: all-trans-retinoic acid Fig. 7 with image from Dalgin et al., 2011
posterior pancreatic bud has fewer parts of type pancreatic B cell, abnormal AB + MO2-mnx1 standard conditions Fig. 4 with imageFig. 7 with image from Dalgin et al., 2011
pancreatic A cell differentiation increased occurrence, abnormal AB + MO2-mnx1 chemical treatment: all-trans-retinoic acid Fig. 7 with image from Dalgin et al., 2011
posterior pancreatic bud has extra parts of type pancreatic A cell, abnormal AB + MO2-mnx1 chemical treatment: all-trans-retinoic acid Fig. 7 with image from Dalgin et al., 2011
endocrine pancreas development increased process quality, abnormal AB + MO2-mnx1 chemical treatment: all-trans-retinoic acid Fig. 7 with image from Dalgin et al., 2011
type B pancreatic cell differentiation decreased occurrence, abnormal AB + MO2-mnx1 standard conditions Fig. 4 with imageFig. 7 with image from Dalgin et al., 2011
retinoic acid receptor signaling pathway increased occurrence, abnormal AB + MO2-mnx1 chemical treatment: all-trans-retinoic acid Fig. 7 with image from Dalgin et al., 2011
type B pancreatic cell differentiation decreased occurrence, abnormal AB + MO2-mnx1 chemical treatment: all-trans-retinoic acid Fig. 7 with image from Dalgin et al., 2011
posterior pancreatic bud has extra parts of type pancreatic A cell, abnormal AB + MO2-mnx1 standard conditions Fig. 4 with imageFig. 7 with imageFig. S6 with image from Dalgin et al., 2011
pancreatic A cell differentiation increased occurrence, abnormal AB + MO2-mnx1 standard conditions Fig. 4 with imageFig. 7 with imageFig. S6 with image from Dalgin et al., 2011
posterior pancreatic bud decreased size, abnormal WT + MO2-mnx1 standard conditions Fig. 1 with image from Kimmel et al., 2011
pancreatic B cell decreased amount, abnormal WT + MO2-mnx1 standard conditions Fig. 1 with image from Kimmel et al., 2011
endocrine pancreas development disrupted, abnormal WT + MO2-mnx1 standard conditions Fig. 1 with image from Kimmel et al., 2011
pancreas posterior region has extra parts of type endocrine cell, abnormal nl1Tg + MO2-mnx1 chemical treatment: DAPT Fig. 6 with image from Kimmel et al., 2011
endocrine pancreas has extra parts of type pancreatic A cell, abnormal nl1Tg + MO2-mnx1 standard conditions Fig. 5 with image from Dalgin et al., 2011
extrapancreatic duct endocrine cell decreased amount, abnormal nl1Tg + MO2-mnx1 standard conditions Fig. 5 with image from Kimmel et al., 2011
endocrine pancreas has fewer parts of type pancreatic B cell, abnormal nl1Tg + MO2-mnx1 standard conditions Fig. 5 with image from Dalgin et al., 2011
pancreatic A cell differentiation increased occurrence, abnormal os26Tg + MO2-mnx1 standard conditions Fig. 8 with image from Dalgin et al., 2011
endocrine pancreas has extra parts of type pancreatic A cell, abnormal os26Tg + MO2-mnx1 standard conditions Fig. 8 with image from Dalgin et al., 2011
type B pancreatic cell differentiation decreased occurrence, abnormal os26Tg + MO2-mnx1 standard conditions Fig. 8 with image from Dalgin et al., 2011
endocrine pancreas has fewer parts of type pancreatic B cell, abnormal os26Tg + MO2-mnx1 standard conditions Fig. 8 with image from Dalgin et al., 2011
pancreatic B cell decreased amount, abnormal m1018Tg; nl1Tg + MO2-mnx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
type B pancreatic cell proliferation disrupted, abnormal m1018Tg; nl1Tg + MO2-mnx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
endocrine pancreas development disrupted, abnormal m1018Tg; nl1Tg + MO2-mnx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
type B pancreatic cell differentiation disrupted, abnormal m1018Tg; nl1Tg + MO2-mnx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
endocrine pancreas development disrupted, abnormal WT + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 1 with image from Kimmel et al., 2011
pancreatic B cell absent, abnormal WT + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 1 with image from Kimmel et al., 2011
endocrine pancreas development disrupted, abnormal nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 2 with image from Kimmel et al., 2011
posterior pancreatic bud elongated, abnormal nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 2 with image from Kimmel et al., 2011
posterior pancreatic bud cellular motility, abnormal nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 2 with image from Kimmel et al., 2011
type B pancreatic cell differentiation absent, abnormal m1018Tg; nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 2 with image from Kimmel et al., 2011
endocrine pancreas has fewer parts of type endodermal cell, abnormal m1018Tg; nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
type B pancreatic cell proliferation disrupted, abnormal m1018Tg; nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
endocrine pancreas development disrupted, abnormal m1018Tg; nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 2 with image from Kimmel et al., 2011
type B pancreatic cell differentiation disrupted, abnormal m1018Tg; nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
pancreatic B cell absent, abnormal m1018Tg; nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 2 with imageFig. 3 with image from Kimmel et al., 2011
endocrine pancreas decreased size, abnormal m1018Tg; nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
Citations