Morpholino

MO1-cdc14b

ID
ZDB-MRPHLNO-110118-1
Name
MO1-cdc14b
Previous Names
  • MORPH1734 (1)
Target
Sequence
5' - CACATGACTGTTGGAAAAGAACAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cdc14b
No data available
Phenotype
Phenotype resulting from MO1-cdc14b
Phenotype Fish Figures
brain hydrocephalic, abnormal WT + MO1-cdc14b Fig. 1 with image from Clément et al., 2011
embryonic heart tube left/right pattern formation disrupted, abnormal AB + MO1-cdc14b Fig. 3 with imageFig. 5 with image from Clément et al., 2012
Fig. 2 with image from Clément et al., 2011
heart jogging disrupted, abnormal AB + MO1-cdc14b Fig. 3 with imageFig. 5 with image from Clément et al., 2012
heart looping disrupted, abnormal WT + MO1-cdc14b Fig. 2 with image from Clément et al., 2011
Kupffer's vesicle cilium decreased amount, abnormal s870Tg + MO1-cdc14b Fig. 3 with image from Clément et al., 2011
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-cdc14b Fig. 3 with imageFig. 7 with imageFig. 8 with image from Clément et al., 2011
Kupffer's vesicle motile cilium decreased length, abnormal AB + MO1-cdc14b Fig. 6 with image from Clément et al., 2012
left/right pattern formation occurrence, abnormal WT + MO1-cdc14b Fig. 3 with image from Clément et al., 2012
Fig. 2 with image from Clément et al., 2011
macula saccule cell decreased amount, abnormal WT + MO1-cdc14b Fig. 5 with image from Clément et al., 2011
macula saccule cilium decreased amount, abnormal WT + MO1-cdc14b Fig. 5 with image from Clément et al., 2011
macula saccule cilium decreased length, abnormal WT + MO1-cdc14b Fig. 5 with image from Clément et al., 2011
pericardium edematous, abnormal WT + MO1-cdc14b Fig. 1 with image from Clément et al., 2011
post-vent region curved dorsal, abnormal WT + MO1-cdc14b Fig. 1 with image from Clément et al., 2011
post-vent region curved ventral, abnormal WT + MO1-cdc14b Fig. 1 with image from Clément et al., 2011
pronephric duct cilium decreased amount, abnormal WT + MO1-cdc14b Fig. 4 with image from Clément et al., 2011
pronephric duct cilium decreased length, abnormal WT + MO1-cdc14b Fig. 4 with image from Clément et al., 2011
pronephros cystic, abnormal WT + MO1-cdc14b Fig. 1 with image from Clément et al., 2011
whole organism decreased size, abnormal AB + MO1-cdc14b Fig. 2 with image from Clément et al., 2012
whole organism increased curvature, abnormal AB + MO1-cdc14b Fig. 2 with image from Clément et al., 2012
Phenotype of all Fish created by or utilizing MO1-cdc14b
Phenotype Fish Conditions Figures
Kupffer's vesicle motile cilium decreased length, abnormal AB + MO1-cdc14b standard conditions Fig. 6 with image from Clément et al., 2012
whole organism increased curvature, abnormal AB + MO1-cdc14b standard conditions Fig. 2 with image from Clément et al., 2012
embryonic heart tube left/right pattern formation disrupted, abnormal AB + MO1-cdc14b standard conditions Fig. 3 with imageFig. 5 with image from Clément et al., 2012
whole organism decreased size, abnormal AB + MO1-cdc14b standard conditions Fig. 2 with image from Clément et al., 2012
heart jogging disrupted, abnormal AB + MO1-cdc14b standard conditions Fig. 3 with imageFig. 5 with image from Clément et al., 2012
left/right pattern formation occurrence, abnormal AB + MO1-cdc14b standard conditions Fig. 3 with image from Clément et al., 2012
pronephros cystic, abnormal WT + MO1-cdc14b standard conditions Fig. 1 with image from Clément et al., 2011
embryonic heart tube left/right pattern formation disrupted, abnormal WT + MO1-cdc14b standard conditions Fig. 2 with image from Clément et al., 2011
macula saccule cell decreased amount, abnormal WT + MO1-cdc14b standard conditions Fig. 5 with image from Clément et al., 2011
pronephric duct cilium decreased amount, abnormal WT + MO1-cdc14b standard conditions Fig. 4 with image from Clément et al., 2011
macula saccule cilium decreased amount, abnormal WT + MO1-cdc14b standard conditions Fig. 5 with image from Clément et al., 2011
brain hydrocephalic, abnormal WT + MO1-cdc14b standard conditions Fig. 1 with image from Clément et al., 2011
post-vent region curved ventral, abnormal WT + MO1-cdc14b standard conditions Fig. 1 with image from Clément et al., 2011
macula saccule cilium decreased length, abnormal WT + MO1-cdc14b standard conditions Fig. 5 with image from Clément et al., 2011
pericardium edematous, abnormal WT + MO1-cdc14b standard conditions Fig. 1 with image from Clément et al., 2011
heart looping disrupted, abnormal WT + MO1-cdc14b standard conditions Fig. 2 with image from Clément et al., 2011
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-cdc14b standard conditions Fig. 7 with imageFig. 8 with image from Clément et al., 2011
pronephric duct cilium decreased length, abnormal WT + MO1-cdc14b standard conditions Fig. 4 with image from Clément et al., 2011
post-vent region curved dorsal, abnormal WT + MO1-cdc14b standard conditions Fig. 1 with image from Clément et al., 2011
left/right pattern formation occurrence, abnormal WT + MO1-cdc14b standard conditions Fig. 2 with image from Clément et al., 2011
Kupffer's vesicle cilium decreased length, abnormal s870Tg + MO1-cdc14b standard conditions Fig. 3 with image from Clément et al., 2011
Kupffer's vesicle cilium decreased amount, abnormal s870Tg + MO1-cdc14b standard conditions Fig. 3 with image from Clément et al., 2011
left/right pattern formation occurrence, abnormal twu34Tg + MO1-cdc14b standard conditions Fig. 2 with image from Clément et al., 2011
embryonic heart tube left/right pattern formation disrupted, abnormal cdc14bvu426Tg/vu426Tg; twu34Tg + MO1-cdc14b standard conditions Fig. 2 with image from Clément et al., 2011
Kupffer's vesicle cilium decreased length, abnormal fgf8ax15/+ + MO1-cdc14b standard conditions Fig. 7 with image from Clément et al., 2011
Kupffer's vesicle cilium decreased length, abnormal fgf8ax15/x15 + MO1-cdc14b standard conditions Fig. 7 with image from Clément et al., 2011
cilium assembly disrupted, abnormal AB + MO1-cdc14aa + MO1-cdc14b standard conditions Fig. 5 with image from Clément et al., 2012
Kupffer's vesicle motile cilium decreased length, abnormal AB + MO1-cdc14aa + MO1-cdc14b standard conditions Fig. 5 with image from Clément et al., 2012
Citations