Morpholino

MO3-flt4

ID
ZDB-MRPHLNO-100205-4
Name
MO3-flt4
Previous Names
  • flt4 ATG MO (1)
Target
Sequence
5' - CTCTTCATTTCCAGGTTTCAAGTCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-flt4
Phenotype
Phenotype resulting from MO3-flt4
Phenotype Fish Figures
angiogenesis process quality, abnormal WT + MO3-flt4 Fig. 3 with image from Lai et al., 2014
blood vessel development disrupted, abnormal y1Tg + MO3-flt4 Fig. 3 with image from Hogan et al., 2009
facial lymphatic vessel lateral region decreased length, abnormal nz150Tg + MO3-flt4 Fig. 1 with image from Astin et al., 2014
facial lymphatic vessel lymphangiogenesis decreased process quality, abnormal nz150Tg + MO3-flt4 Fig. 2 with image from Astin et al., 2014
facial lymphatic vessel lymphangiogenic sprout aplastic, abnormal nz150Tg + MO3-flt4 Fig. 2 with image from Astin et al., 2014
heart myl7 expression decreased distribution, abnormal WT + MO3-flt4 Fig. 6 with image from Monaghan et al., 2024
heart decreased size, abnormal WT + MO3-flt4 Fig. 6 with image from Monaghan et al., 2024
heart morphology, abnormal WT + MO3-flt4 Fig. 6 with image from Monaghan et al., 2024
heart looping decreased process quality, abnormal WT + MO3-flt4 Fig. 6 with image from Monaghan et al., 2024
intersegmental vein decreased length, abnormal WT + MO3-flt4 Fig. 3 with imageFig. 8 with image from Lai et al., 2014
intersegmental vessel angiogenesis process quality, abnormal WT + MO3-flt4 Fig. 3 with imageFig. 8 with image from Lai et al., 2014
intestine lymphangiogenesis decreased process quality, abnormal nz101Tg; s843Tg + MO3-flt4 Fig. S5 with image from Astin et al., 2014
lymph vessel development disrupted, abnormal y1Tg + MO3-flt4 Fig. 3 with image from Hogan et al., 2009
lymph vessel morphogenesis disrupted, abnormal y1Tg + MO3-flt4 Fig. 7 from Huang et al., 2013
lymphangioblast cord absent, abnormal y1Tg + MO3-flt4 Fig. 6 with image from Le Guen et al., 2014
MAPK cascade disrupted, abnormal y1Tg + MO3-flt4 Fig. 4 with image from Le Guen et al., 2014
midbrain lymph vessel lacks all parts of type endothelial cell, abnormal nz101Tg; s843Tg + MO3-flt4 Fig. S7 from Bower et al., 2017
posterior cardinal vein lacks parts or has fewer parts of type lymphangiogenic sprout, abnormal nz150Tg + MO3-flt4 Fig. S2 with image from Astin et al., 2014
posterior cardinal vein vascular sprouts absent, abnormal y1Tg + MO3-flt4 Fig. 6 from Hermans et al., 2010
posterior cardinal vein vascular sprouts decreased amount, abnormal y1Tg + MO3-flt4 Fig. 6 from Hermans et al., 2010
primordial hindbrain channel absence of anatomical entity, abnormal s843Tg + MO3-flt4 Fig. S8 from Monaghan et al., 2024
primordial hindbrain channel EGFP expression absent, abnormal s843Tg + MO3-flt4 Fig. S8 from Monaghan et al., 2024
primordial hindbrain channel aplastic, abnormal y1Tg + MO3-flt4 Fig. 3 with image from Hogan et al., 2009
thoracic duct absent, abnormal y1Tg + MO3-flt4 Fig. 6 from Hermans et al., 2010
thoracic duct aplastic, abnormal nz150Tg + MO3-flt4 Fig. 1 with image from Astin et al., 2014
Fig. 3 with image from Hogan et al., 2009
thoracic duct decreased length, abnormal y1Tg + MO3-flt4 Fig. 6 from Hermans et al., 2010
thoracic duct hypoplastic, abnormal y1Tg + MO3-flt4 Fig. 7 from Huang et al., 2013
thoracic duct lymphangiogenesis decreased process quality, abnormal nz150Tg + MO3-flt4 Fig. 1 with imageFig. 2 with image from Astin et al., 2014
venous endothelial cell migration involved in lymph vessel development disrupted, abnormal y1Tg + MO3-flt4 Fig. 6 with image from Le Guen et al., 2014
Phenotype of all Fish created by or utilizing MO3-flt4
Phenotype Fish Conditions Figures
heart looping decreased process quality, abnormal WT + MO3-flt4 control Fig. 6 with image from Monaghan et al., 2024
heart decreased size, abnormal WT + MO3-flt4 control Fig. 6 with image from Monaghan et al., 2024
intersegmental vessel angiogenesis process quality, abnormal WT + MO3-flt4 standard conditions Fig. 3 with image from Lai et al., 2014
heart myl7 expression decreased distribution, abnormal WT + MO3-flt4 control Fig. 6 with image from Monaghan et al., 2024
angiogenesis process quality, abnormal WT + MO3-flt4 standard conditions Fig. 3 with image from Lai et al., 2014
intersegmental vein decreased length, abnormal WT + MO3-flt4 standard conditions Fig. 3 with image from Lai et al., 2014
heart morphology, abnormal WT + MO3-flt4 control Fig. 6 with image from Monaghan et al., 2024
thoracic duct lymphangiogenesis decreased process quality, abnormal nz150Tg + MO3-flt4 standard conditions Fig. 1 with imageFig. 2 with image from Astin et al., 2014
posterior cardinal vein lacks parts or has fewer parts of type lymphangiogenic sprout, abnormal nz150Tg + MO3-flt4 standard conditions Fig. S2 with image from Astin et al., 2014
facial lymphatic vessel lateral region decreased length, abnormal nz150Tg + MO3-flt4 standard conditions Fig. 1 with image from Astin et al., 2014
facial lymphatic vessel lymphangiogenesis decreased process quality, abnormal nz150Tg + MO3-flt4 standard conditions Fig. 2 with image from Astin et al., 2014
thoracic duct aplastic, abnormal nz150Tg + MO3-flt4 standard conditions Fig. 1 with image from Astin et al., 2014
facial lymphatic vessel lymphangiogenic sprout aplastic, abnormal nz150Tg + MO3-flt4 standard conditions Fig. 2 with image from Astin et al., 2014
primordial hindbrain channel EGFP expression absent, abnormal s843Tg + MO3-flt4 control Fig. S8 from Monaghan et al., 2024
primordial hindbrain channel absence of anatomical entity, abnormal s843Tg + MO3-flt4 control Fig. S8 from Monaghan et al., 2024
primordial hindbrain channel aplastic, abnormal y1Tg + MO3-flt4 standard conditions Fig. 3 with image from Hogan et al., 2009
venous endothelial cell migration involved in lymph vessel development disrupted, abnormal y1Tg + MO3-flt4 standard conditions Fig. 6 with image from Le Guen et al., 2014
thoracic duct absent, abnormal y1Tg + MO3-flt4 standard conditions Fig. 6 from Hermans et al., 2010
posterior cardinal vein vascular sprouts decreased amount, abnormal y1Tg + MO3-flt4 standard conditions Fig. 6 from Hermans et al., 2010
thoracic duct decreased length, abnormal y1Tg + MO3-flt4 standard conditions Fig. 6 from Hermans et al., 2010
lymphangioblast cord absent, abnormal y1Tg + MO3-flt4 standard conditions Fig. 6 with image from Le Guen et al., 2014
blood vessel development disrupted, abnormal y1Tg + MO3-flt4 standard conditions Fig. 3 with image from Hogan et al., 2009
thoracic duct hypoplastic, abnormal y1Tg + MO3-flt4 standard conditions Fig. 7 from Huang et al., 2013
intersegmental vein decreased length, abnormal y1Tg + MO3-flt4 standard conditions Fig. 8 with image from Lai et al., 2014
lymph vessel morphogenesis disrupted, abnormal y1Tg + MO3-flt4 standard conditions Fig. 7 from Huang et al., 2013
lymph vessel development disrupted, abnormal y1Tg + MO3-flt4 standard conditions Fig. 3 with image from Hogan et al., 2009
MAPK cascade disrupted, abnormal y1Tg + MO3-flt4 standard conditions Fig. 4 with image from Le Guen et al., 2014
thoracic duct aplastic, abnormal y1Tg + MO3-flt4 standard conditions Fig. 3 with image from Hogan et al., 2009
posterior cardinal vein vascular sprouts absent, abnormal y1Tg + MO3-flt4 standard conditions Fig. 6 from Hermans et al., 2010
intersegmental vessel angiogenesis process quality, abnormal y1Tg + MO3-flt4 standard conditions Fig. 8 with image from Lai et al., 2014
intestine lymphangiogenesis decreased process quality, abnormal nz101Tg; s843Tg + MO3-flt4 standard conditions Fig. S5 with image from Astin et al., 2014
midbrain lymph vessel lacks all parts of type endothelial cell, abnormal nz101Tg; s843Tg + MO3-flt4 standard conditions Fig. S7 from Bower et al., 2017
posterior cardinal vein vascular sprouts absent, abnormal y1Tg + MO1-gipc1 + MO3-flt4 standard conditions Fig. 6 from Hermans et al., 2010
posterior cardinal vein vascular sprouts decreased amount, abnormal y1Tg + MO1-gipc1 + MO3-flt4 standard conditions Fig. 6 from Hermans et al., 2010
thoracic duct absent, abnormal y1Tg + MO1-gipc1 + MO3-flt4 standard conditions Fig. 6 from Hermans et al., 2010
thoracic duct decreased length, abnormal y1Tg + MO1-gipc1 + MO3-flt4 standard conditions Fig. 6 from Hermans et al., 2010
thoracic duct hypoplastic, abnormal y1Tg + MO1-mir126a + MO3-flt4 standard conditions Fig. 6 with image from Chen et al., 2016
vascular lymphangioblast decreased amount, abnormal y1Tg + MO1-mir126a + MO3-flt4 standard conditions Fig. 6 with image from Chen et al., 2016
thoracic duct decreased length, abnormal y1Tg + MO1-mir126a + MO3-flt4 standard conditions Fig. 6 with image from Chen et al., 2016
thoracic duct hypoplastic, abnormal y1Tg + MO1-rasgrp4 + MO3-flt4 standard conditions Fig. 7 from Huang et al., 2013
lymph vessel morphogenesis disrupted, abnormal y1Tg + MO1-rasgrp4 + MO3-flt4 standard conditions Fig. 7 from Huang et al., 2013
posterior cardinal vein lymphangiogenic sprout decreased amount, abnormal y1Tg + MO3-flt4 + MO4-plcg1 control Fig. 6 with image from Chen et al., 2016
posterior cardinal vein lymphangiogenic sprout decreased amount, abnormal y1Tg + MO1-mir126a + MO3-flt4 + MO4-plcg1 control Fig. 6 with image from Chen et al., 2016
intersegmental vessel dorsal region branchiness, ameliorated flt1ka601/ka601; s843Tg + MO3-flt4 standard conditions Fig. 5 with image from Wild et al., 2017
intersegmental vessel vascular sprouts amount, ameliorated flt1ka601/ka601; s843Tg + MO3-flt4 standard conditions Fig. 5 with image from Wild et al., 2017
horizontal myoseptum vascular lymphangioblast decreased amount, exacerbated grb2bmu404/+; hu5333Tg; hu7135Tg + MO3-flt4 standard conditions Fig. 4 with image from Mauri et al., 2021
intersegmental vessel dorsal region branchiness, ameliorated vhlhu2117/hu2117; flt1ka601/ka601; s843Tg + MO3-flt4 standard conditions Fig. 5 with image from Wild et al., 2017
intersegmental vessel vascular sprouts amount, ameliorated vhlhu2117/hu2117; flt1ka601/ka601; s843Tg + MO3-flt4 standard conditions Fig. 5 with image from Wild et al., 2017
Citations