Morpholino

MO4-tfap2a

ID

ZDB-MRPHLNO-080226-1

Name

MO4-tfap2a

Previous Names

ap2a E2I2 (1)

Target

tfap2a (1)

Sequence

5' - AGCTTTTCTTCTTACCTGAACATCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

This is a splice blocking morpholino designed against the exon 2 - intron 2 splice site.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO4-tfap2a

Expressed Gene	Anatomy	Figures
clcnk	pronephric distal early tubule pronephric distal late tubule pronephros distal region	Fig. 3 from Chambers et al., 2019
fgf3	otic vesicle	Fig. 6 from Kantarci et al., 2015
fgf8a	otic vesicle	Fig. 6 from Kantarci et al., 2015
fgf10a	otic vesicle	Fig. 6 from Kantarci et al., 2015
fscn1a	central nervous system (not) cranial neural crest mesoderm	Fig. 1 from Boer et al., 2015
irx1a	pronephric distal early tubule	Fig. 6 from Chambers et al., 2019
irx3b	pronephric distal early tubule pronephric proximal straight tubule	Fig. 6 from Chambers et al., 2019
pax5	otic vesicle antero-ventral region	Fig. 5 from Kantarci et al., 2015
pou3f3b	otic vesicle postero-medial region	Fig. 5 from Kantarci et al., 2015
slc12a1	pronephric distal early tubule	Fig. 3 from Chambers et al., 2019
slc12a3	pronephric distal late tubule	Fig. 3 from Chambers et al., 2019

Phenotype

Phenotype resulting from MO4-tfap2a

Phenotype	Fish	Figures
embryonic viscerocranium morphogenesis decreased process quality, abnormal	TU + MO4-tfap2a	Fig. 1 from Chambers et al., 2019
heart edematous, abnormal	TU + MO4-tfap2a	Fig. 1 from Chambers et al., 2019
Meckel's cartilage malformed, abnormal	TU + MO4-tfap2a	Fig. 1 from Chambers et al., 2019
otic vesicle has fewer parts of type otic vesicle neuroblast (sensu Vertebrata), abnormal	AB + MO4-tfap2a	Fig. 2 from Kantarci et al., 2015
otic vesicle neuroblast fate specification decreased occurrence, abnormal	AB + MO4-tfap2a	Fig. 2 from Kantarci et al., 2015
otic vesicle neurogenesis decreased occurrence, abnormal	AB + MO4-tfap2a	Fig. 4 from Kantarci et al., 2015
pronephric distal early tubule irx1a expression decreased amount, abnormal	TU + MO4-tfap2a	Fig. 6 from Chambers et al., 2019
pronephric distal early tubule clcnk expression decreased amount, abnormal	TU + MO4-tfap2a	Fig. 3 from Chambers et al., 2019
pronephric distal early tubule slc12a1 expression decreased amount, abnormal	TU + MO4-tfap2a	Fig. 3 from Chambers et al., 2019
pronephric distal early tubule clcnk expression decreased distribution, abnormal	TU + MO4-tfap2a	Fig. 3 from Chambers et al., 2019
pronephric distal early tubule irx1a expression decreased distribution, abnormal	TU + MO4-tfap2a	Fig. 6 from Chambers et al., 2019
pronephric distal early tubule slc12a1 expression decreased distribution, abnormal	TU + MO4-tfap2a	Fig. 3 from Chambers et al., 2019
pronephric distal early tubule pronephric nephron tubule epithelial cell differentiation decreased occurrence, abnormal	TU + MO4-tfap2a	Fig. 3 from Chambers et al., 2019
pronephric distal late tubule slc12a3 expression decreased amount, abnormal	TU + MO4-tfap2a	Fig. 3 from Chambers et al., 2019
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal	TU + MO4-tfap2a	Fig. 3 from Chambers et al., 2019
pronephric distal late tubule pronephric nephron tubule epithelial cell differentiation decreased occurrence, abnormal	TU + MO4-tfap2a	Fig. 3 from Chambers et al., 2019
pronephros distal region clcnk expression decreased amount, abnormal	TU + MO4-tfap2a	Fig. 3 from Chambers et al., 2019
pronephros distal region clcnk expression decreased distribution, abnormal	TU + MO4-tfap2a	Fig. 3 from Chambers et al., 2019
statoacoustic (VIII) ganglion has fewer parts of type statoacoustic (VIII) ganglion neuron, abnormal	AB + MO4-tfap2a	Fig. 4 from Kantarci et al., 2015
statoacoustic (VIII) ganglion neuron differentiation decreased rate, abnormal	AB + MO4-tfap2a	Fig. 4 from Kantarci et al., 2015

Phenotype of all Fish created by or utilizing MO4-tfap2a

Phenotype	Fish	Conditions	Figures
otic vesicle neuroblast fate specification decreased occurrence, abnormal	AB + MO4-tfap2a	heat shock	Fig. 6 from Kantarci et al., 2015
otic vesicle neurogenesis decreased occurrence, abnormal	AB + MO4-tfap2a	standard conditions	Fig. 4 from Kantarci et al., 2015
otic vesicle has fewer parts of type otic vesicle neuroblast (sensu Vertebrata), abnormal	AB + MO4-tfap2a	standard conditions	Fig. 2 from Kantarci et al., 2015
otic vesicle neuroblast fate specification decreased occurrence, abnormal	AB + MO4-tfap2a	standard conditions	Fig. 2 from Kantarci et al., 2015
statoacoustic (VIII) ganglion has fewer parts of type statoacoustic (VIII) ganglion neuron, abnormal	AB + MO4-tfap2a	standard conditions	Fig. 4 from Kantarci et al., 2015
statoacoustic (VIII) ganglion neuron differentiation decreased rate, abnormal	AB + MO4-tfap2a	standard conditions	Fig. 4 from Kantarci et al., 2015
embryonic viscerocranium morphogenesis decreased process quality, abnormal	TU + MO4-tfap2a	standard conditions	Fig. 1 from Chambers et al., 2019
pronephros distal region clcnk expression decreased amount, abnormal	TU + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal early tubule slc12a1 expression decreased amount, abnormal	TU + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal early tubule irx1a expression decreased distribution, abnormal	TU + MO4-tfap2a	standard conditions	Fig. 6 from Chambers et al., 2019
pronephric distal early tubule pronephric nephron tubule epithelial cell differentiation decreased occurrence, abnormal	TU + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal early tubule slc12a1 expression decreased distribution, abnormal	TU + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal early tubule clcnk expression decreased distribution, abnormal	TU + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal early tubule clcnk expression decreased amount, abnormal	TU + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal late tubule pronephric nephron tubule epithelial cell differentiation decreased occurrence, abnormal	TU + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephros distal region clcnk expression decreased distribution, abnormal	TU + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
heart edematous, abnormal	TU + MO4-tfap2a	standard conditions	Fig. 1 from Chambers et al., 2019
pronephric distal late tubule slc12a3 expression decreased amount, abnormal	TU + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal	TU + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
Meckel's cartilage malformed, abnormal	TU + MO4-tfap2a	standard conditions	Fig. 1 from Chambers et al., 2019
pronephric distal early tubule irx1a expression decreased amount, abnormal	TU + MO4-tfap2a	standard conditions	Fig. 6 from Chambers et al., 2019
pronephric distal early tubule clcnk expression decreased amount, abnormal	tfap2b^{sa10090/sa10090} + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
posterior pronephric duct cystic, abnormal	tfap2b^{sa10090/sa10090} + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal late tubule slc12a3 expression decreased amount, abnormal	tfap2b^{sa10090/sa10090} + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal early tubule slc12a1 expression decreased amount, abnormal	tfap2b^{sa10090/sa10090} + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal late tubule clcnk expression decreased distribution, abnormal	tfap2b^{sa10090/sa10090} + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal early tubule slc12a1 expression decreased distribution, abnormal	tfap2b^{sa10090/sa10090} + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal late tubule pronephric nephron tubule epithelial cell differentiation decreased occurrence, exacerbated	tfap2b^{sa10090/sa10090} + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal	tfap2b^{sa10090/sa10090} + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal early tubule pronephric nephron tubule epithelial cell differentiation decreased occurrence, abnormal	tfap2b^{sa10090/sa10090} + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal late tubule clcnk expression decreased amount, abnormal	tfap2b^{sa10090/sa10090} + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal early tubule clcnk expression decreased distribution, abnormal	tfap2b^{sa10090/sa10090} + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal early tubule clcnk expression decreased amount, abnormal	TU + MO1-tfap2b + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephros distal region clcnk expression decreased amount, abnormal	TU + MO1-tfap2b + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephros distal region clcnk expression decreased distribution, abnormal	TU + MO1-tfap2b + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal early tubule pronephric nephron tubule epithelial cell differentiation decreased occurrence, exacerbated	TU + MO1-tfap2b + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal late tubule slc12a3 expression decreased amount, abnormal	TU + MO1-tfap2b + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal early tubule slc12a1 expression decreased amount, abnormal	TU + MO1-tfap2b + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal early tubule slc12a1 expression decreased distribution, abnormal	TU + MO1-tfap2b + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal late tubule pronephric nephron tubule epithelial cell differentiation decreased occurrence, exacerbated	TU + MO1-tfap2b + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal	TU + MO1-tfap2b + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal early tubule clcnk expression decreased distribution, abnormal	TU + MO1-tfap2b + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pharyngeal arch cartilage absent, abnormal	WT + MO2-foxd3 + MO3-foxd3 + MO4-tfap2a	standard conditions	Fig. 4 from Chen et al., 2014
pharyngeal arch tendon absent, abnormal	WT + MO2-foxd3 + MO3-foxd3 + MO4-tfap2a	standard conditions	Fig. 4 from Chen et al., 2014
anterior lateral line aplastic, abnormal	WT + MO2-tfap2c + MO4-tfap2a	standard conditions	Fig. 1 from Bhat et al., 2013
lens placode aplastic, abnormal	WT + MO2-tfap2c + MO4-tfap2a	standard conditions	Fig. 1 from Bhat et al., 2013
olfactory field aplastic, abnormal	WT + MO2-tfap2c + MO4-tfap2a	standard conditions	Fig. 1 from Bhat et al., 2013
adenohypophyseal placode aplastic, abnormal	WT + MO2-tfap2c + MO4-tfap2a	standard conditions	Fig. 1 from Bhat et al., 2013
olfactory placode development decreased occurrence, abnormal	WT + MO2-tfap2c + MO4-tfap2a	standard conditions	Fig. 1 from Bhat et al., 2013
otic placode aplastic, abnormal	WT + MO2-tfap2c + MO4-tfap2a	standard conditions	Fig. 1 from Bhat et al., 2013
olfactory pit aplastic, abnormal	WT + MO2-tfap2c + MO4-tfap2a	standard conditions	Fig. 1 from Bhat et al., 2013
lens aplastic, abnormal	WT + MO2-tfap2c + MO4-tfap2a	standard conditions	Fig. 1 from Bhat et al., 2013
otic placode formation decreased occurrence, abnormal	WT + MO2-tfap2c + MO4-tfap2a	standard conditions	Fig. 1 from Bhat et al., 2013
epibranchial ganglion aplastic, abnormal	WT + MO2-tfap2c + MO4-tfap2a	standard conditions	Fig. 1 from Bhat et al., 2013
neural crest cell development disrupted, abnormal	WT + MO2-tfap2c + MO4-tfap2a	standard conditions	Fig. 2 , Fig. 3 , Fig. 5 from Van Otterloo et al., 2012
whole organism curved ventral, abnormal	WT + MO2-tfap2c + MO4-tfap2a	standard conditions	Fig. S1 from Li et al., 2007
post-vent region decreased length, abnormal	WT + MO2-tfap2c + MO4-tfap2a	standard conditions	Fig. S1 from Li et al., 2007
extension aplastic, abnormal	WT + MO2-tfap2c + MO4-tfap2a	standard conditions	Fig. S1 from Li et al., 2007
trigeminal placode aplastic, abnormal	WT + MO2-tfap2c + MO4-tfap2a	standard conditions	Fig. 1 from Bhat et al., 2013
ectodermal placode development decreased occurrence, abnormal	WT + MO2-tfap2c + MO4-tfap2a	standard conditions	Fig. 1 from Bhat et al., 2013
melanocyte absent, abnormal	WT + MO2-tfap2c + MO4-tfap2a	standard conditions	Fig. S1 from Li et al., 2007
otic vesicle hypoplastic, abnormal	WT + MO2-tfap2c + MO4-tfap2a	standard conditions	Fig. 1 , Fig. 5 from Bhat et al., 2013
melanocyte decreased amount, abnormal	WT + MO2-tfap2c + MO4-tfap2a	standard conditions	Fig. S1 from Li et al., 2007
lens morphology, abnormal	WT + MO2-foxi1 + MO2-gata3 + MO2-tfap2c + MO4-tfap2a	standard conditions	Fig. 4 from Kwon et al., 2010
olfactory pit morphology, abnormal	WT + MO2-foxi1 + MO2-gata3 + MO2-tfap2c + MO4-tfap2a	standard conditions	Fig. 4 from Kwon et al., 2010

Citations