Morpholino

MO4-tfap2a

ID
ZDB-MRPHLNO-080226-1
Name
MO4-tfap2a
Previous Names
  • ap2a E2I2 (1)
Target
Sequence
5' - AGCTTTTCTTCTTACCTGAACATCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a splice blocking morpholino designed against the exon 2 - intron 2 splice site.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-tfap2a
Phenotype
Phenotype resulting from MO4-tfap2a
Phenotype Fish Figures
embryonic viscerocranium morphogenesis decreased process quality, abnormal TU + MO4-tfap2a Fig. 1 with image from Chambers et al., 2019
heart edematous, abnormal TU + MO4-tfap2a Fig. 1 with image from Chambers et al., 2019
Meckel's cartilage malformed, abnormal TU + MO4-tfap2a Fig. 1 with image from Chambers et al., 2019
otic vesicle has fewer parts of type otic vesicle neuroblast (sensu Vertebrata), abnormal AB + MO4-tfap2a Fig. 2 with image from Kantarci et al., 2015
otic vesicle neuroblast fate specification decreased occurrence, abnormal AB + MO4-tfap2a Fig. 2 with image from Kantarci et al., 2015
otic vesicle neurogenesis decreased occurrence, abnormal AB + MO4-tfap2a Fig. 4 with image from Kantarci et al., 2015
pronephric distal early tubule irx1a expression decreased amount, abnormal TU + MO4-tfap2a Fig. 6 with image from Chambers et al., 2019
pronephric distal early tubule clcnk expression decreased amount, abnormal TU + MO4-tfap2a Fig. 3 with image from Chambers et al., 2019
pronephric distal early tubule slc12a1 expression decreased amount, abnormal TU + MO4-tfap2a Fig. 3 with image from Chambers et al., 2019
pronephric distal early tubule clcnk expression decreased distribution, abnormal TU + MO4-tfap2a Fig. 3 with image from Chambers et al., 2019
pronephric distal early tubule irx1a expression decreased distribution, abnormal TU + MO4-tfap2a Fig. 6 with image from Chambers et al., 2019
pronephric distal early tubule slc12a1 expression decreased distribution, abnormal TU + MO4-tfap2a Fig. 3 with image from Chambers et al., 2019
pronephric distal early tubule pronephric nephron tubule epithelial cell differentiation decreased occurrence, abnormal TU + MO4-tfap2a Fig. 3 with image from Chambers et al., 2019
pronephric distal late tubule slc12a3 expression decreased amount, abnormal TU + MO4-tfap2a Fig. 3 with image from Chambers et al., 2019
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO4-tfap2a Fig. 3 with image from Chambers et al., 2019
pronephric distal late tubule pronephric nephron tubule epithelial cell differentiation decreased occurrence, abnormal TU + MO4-tfap2a Fig. 3 with image from Chambers et al., 2019
pronephros distal region clcnk expression decreased amount, abnormal TU + MO4-tfap2a Fig. 3 with image from Chambers et al., 2019
pronephros distal region clcnk expression decreased distribution, abnormal TU + MO4-tfap2a Fig. 3 with image from Chambers et al., 2019
statoacoustic (VIII) ganglion has fewer parts of type statoacoustic (VIII) ganglion neuron, abnormal AB + MO4-tfap2a Fig. 4 with image from Kantarci et al., 2015
statoacoustic (VIII) ganglion neuron differentiation decreased rate, abnormal AB + MO4-tfap2a Fig. 4 with image from Kantarci et al., 2015
Phenotype of all Fish created by or utilizing MO4-tfap2a
Phenotype Fish Conditions Figures
otic vesicle neuroblast fate specification decreased occurrence, abnormal AB + MO4-tfap2a heat shock Fig. 6 with image from Kantarci et al., 2015
otic vesicle neurogenesis decreased occurrence, abnormal AB + MO4-tfap2a standard conditions Fig. 4 with image from Kantarci et al., 2015
otic vesicle has fewer parts of type otic vesicle neuroblast (sensu Vertebrata), abnormal AB + MO4-tfap2a standard conditions Fig. 2 with image from Kantarci et al., 2015
otic vesicle neuroblast fate specification decreased occurrence, abnormal AB + MO4-tfap2a standard conditions Fig. 2 with image from Kantarci et al., 2015
statoacoustic (VIII) ganglion has fewer parts of type statoacoustic (VIII) ganglion neuron, abnormal AB + MO4-tfap2a standard conditions Fig. 4 with image from Kantarci et al., 2015
statoacoustic (VIII) ganglion neuron differentiation decreased rate, abnormal AB + MO4-tfap2a standard conditions Fig. 4 with image from Kantarci et al., 2015
embryonic viscerocranium morphogenesis decreased process quality, abnormal TU + MO4-tfap2a standard conditions Fig. 1 with image from Chambers et al., 2019
pronephros distal region clcnk expression decreased amount, abnormal TU + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal early tubule slc12a1 expression decreased amount, abnormal TU + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal early tubule irx1a expression decreased distribution, abnormal TU + MO4-tfap2a standard conditions Fig. 6 with image from Chambers et al., 2019
pronephric distal early tubule pronephric nephron tubule epithelial cell differentiation decreased occurrence, abnormal TU + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal early tubule slc12a1 expression decreased distribution, abnormal TU + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal early tubule clcnk expression decreased distribution, abnormal TU + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal early tubule clcnk expression decreased amount, abnormal TU + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal late tubule pronephric nephron tubule epithelial cell differentiation decreased occurrence, abnormal TU + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
heart edematous, abnormal TU + MO4-tfap2a standard conditions Fig. 1 with image from Chambers et al., 2019
pronephros distal region clcnk expression decreased distribution, abnormal TU + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal late tubule slc12a3 expression decreased amount, abnormal TU + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
Meckel's cartilage malformed, abnormal TU + MO4-tfap2a standard conditions Fig. 1 with image from Chambers et al., 2019
pronephric distal early tubule irx1a expression decreased amount, abnormal TU + MO4-tfap2a standard conditions Fig. 6 with image from Chambers et al., 2019
pronephric distal early tubule clcnk expression decreased amount, abnormal tfap2bsa10090/sa10090 + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
posterior pronephric duct cystic, abnormal tfap2bsa10090/sa10090 + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal late tubule slc12a3 expression decreased amount, abnormal tfap2bsa10090/sa10090 + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal early tubule slc12a1 expression decreased amount, abnormal tfap2bsa10090/sa10090 + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal late tubule clcnk expression decreased distribution, abnormal tfap2bsa10090/sa10090 + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal early tubule slc12a1 expression decreased distribution, abnormal tfap2bsa10090/sa10090 + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal late tubule pronephric nephron tubule epithelial cell differentiation decreased occurrence, exacerbated tfap2bsa10090/sa10090 + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal tfap2bsa10090/sa10090 + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal early tubule pronephric nephron tubule epithelial cell differentiation decreased occurrence, abnormal tfap2bsa10090/sa10090 + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal late tubule clcnk expression decreased amount, abnormal tfap2bsa10090/sa10090 + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal early tubule clcnk expression decreased distribution, abnormal tfap2bsa10090/sa10090 + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal early tubule clcnk expression decreased amount, abnormal TU + MO1-tfap2b + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephros distal region clcnk expression decreased distribution, abnormal TU + MO1-tfap2b + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephros distal region clcnk expression decreased amount, abnormal TU + MO1-tfap2b + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal early tubule pronephric nephron tubule epithelial cell differentiation decreased occurrence, exacerbated TU + MO1-tfap2b + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal late tubule slc12a3 expression decreased amount, abnormal TU + MO1-tfap2b + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal early tubule slc12a1 expression decreased amount, abnormal TU + MO1-tfap2b + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal early tubule slc12a1 expression decreased distribution, abnormal TU + MO1-tfap2b + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal late tubule pronephric nephron tubule epithelial cell differentiation decreased occurrence, exacerbated TU + MO1-tfap2b + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO1-tfap2b + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal early tubule clcnk expression decreased distribution, abnormal TU + MO1-tfap2b + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pharyngeal arch cartilage absent, abnormal WT + MO2-foxd3 + MO3-foxd3 + MO4-tfap2a standard conditions Fig. 4 with image from Chen et al., 2014
pharyngeal arch tendon absent, abnormal WT + MO2-foxd3 + MO3-foxd3 + MO4-tfap2a standard conditions Fig. 4 with image from Chen et al., 2014
anterior lateral line aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
lens placode aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
olfactory field aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
adenohypophyseal placode aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
olfactory placode development decreased occurrence, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
otic placode aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
olfactory pit aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
otic placode formation decreased occurrence, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
lens aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
epibranchial ganglion aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
neural crest cell development disrupted, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 2 with imageFig. 3 with imageFig. 5 with image from Van Otterloo et al., 2012
whole organism curved ventral, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. S1 with image from Li et al., 2007
post-vent region decreased length, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. S1 with image from Li et al., 2007
extension aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. S1 with image from Li et al., 2007
trigeminal placode aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
ectodermal placode development decreased occurrence, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
melanocyte absent, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. S1 with image from Li et al., 2007
otic vesicle hypoplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with imageFig. 5 with image from Bhat et al., 2013
melanocyte decreased amount, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. S1 with image from Li et al., 2007
lens morphology, abnormal WT + MO2-foxi1 + MO2-gata3 + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 4 with image from Kwon et al., 2010
olfactory pit morphology, abnormal WT + MO2-foxi1 + MO2-gata3 + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 4 with image from Kwon et al., 2010
Citations