Morpholino

MO5-tp53

ID
ZDB-MRPHLNO-070719-1
Name
MO5-tp53
Previous Names
None
Target
Sequence
5' - GACCTCCTCTCCACTAAACTACGAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-tp53
Expressed Gene Anatomy Figures
sod1 Fig. 1 from Chen et al., 2011
Phenotype
Phenotype resulting from MO5-tp53
No data available
Phenotype of all Fish created by or utilizing MO5-tp53
Phenotype Fish Conditions Figures
retinal ganglion cell decreased amount, abnormal AB + MO1-atoh8 + MO5-tp53 standard conditions Fig. 8 with image from Yao et al., 2010
pharyngeal arch 3-7 decreased size, abnormal AB + MO1-atoh8 + MO5-tp53 standard conditions Fig. 4 with image from Yao et al., 2010
somite cuboid, abnormal AB + MO1-atoh8 + MO5-tp53 standard conditions Fig. 12 with image from Yao et al., 2010
somite border deformed, abnormal AB + MO1-atoh8 + MO5-tp53 standard conditions Fig. 4 with image,  Fig. 11 with image from Yao et al., 2010
retina disorganized, abnormal AB + MO1-atoh8 + MO5-tp53 standard conditions Fig. 10 with image from Yao et al., 2010
skeletal muscle cell disorganized, abnormal AB + MO1-atoh8 + MO5-tp53 standard conditions Fig. 12 with image from Yao et al., 2010
vertical myoseptum decreased length, abnormal AB + MO1-atoh8 + MO5-tp53 standard conditions Fig. 12 with image from Yao et al., 2010
retinal neural layer morphology, abnormal AB + MO1-atoh8 + MO5-tp53 standard conditions Fig. 8 with image from Yao et al., 2010
retina development in camera-type eye disrupted, abnormal AB + MO1-atoh8 + MO5-tp53 standard conditions Fig. 10 with image from Yao et al., 2010
extension decreased length, abnormal AB + MO1-atoh8 + MO5-tp53 standard conditions Fig. 4 with image from Yao et al., 2010
somite U-shaped, abnormal AB + MO1-atoh8 + MO5-tp53 standard conditions Fig. 4 with image,  Fig. 11 with image,  Fig. 12 with image from Yao et al., 2010
whole organism anterior-posterior axis curved ventral, abnormal AB + MO1-atoh8 + MO5-tp53 standard conditions Fig. 4 with image from Yao et al., 2010
somitogenesis disrupted, abnormal AB + MO1-atoh8 + MO5-tp53 standard conditions Fig. 11 with image from Yao et al., 2010
post-vent region decreased flexibility, abnormal AB + MO1-atoh8 + MO5-tp53 standard conditions Fig. 4 with image from Yao et al., 2010
skeletal muscle cell differentiation disrupted, abnormal AB + MO1-atoh8 + MO5-tp53 standard conditions Fig. 12 with image from Yao et al., 2010
retina morphology, abnormal AB + MO1-atoh8 + MO5-tp53 standard conditions Fig. 9 with image from Yao et al., 2010
vertical myoseptum structure, abnormal AB + MO1-atoh8 + MO5-tp53 standard conditions Fig. 12 with image from Yao et al., 2010
retina decreased size, abnormal AB + MO1-atoh8 + MO5-tp53 standard conditions Fig. 8 with image from Yao et al., 2010
retina apoptotic, abnormal AB + MO1-atoh8 + MO5-tp53 standard conditions Fig. 9 with image from Yao et al., 2010
somite fused with somite, abnormal AB + MO1-atoh8 + MO5-tp53 standard conditions Fig. 4 with image from Yao et al., 2010
somite posterior-most region decreased amount, abnormal AB + MO1-atoh8 + MO5-tp53 standard conditions Fig. 11 with image from Yao et al., 2010
brain shape, abnormal AB + MO1-atoh8 + MO5-tp53 standard conditions Fig. 4 with image from Yao et al., 2010
blood circulation disrupted, abnormal AB + MO1-atoh8 + MO5-tp53 standard conditions Fig. 4 with image from Yao et al., 2010
retina layer formation disrupted, abnormal AB + MO1-atoh8 + MO5-tp53 standard conditions Fig. 8 with image from Yao et al., 2010
eye decreased size, abnormal AB + MO1-atoh8 + MO5-tp53 standard conditions Fig. 4 with image from Yao et al., 2010
head hypotrophic, abnormal AB + MO1-atoh8 + MO5-tp53 standard conditions Fig. 4 with image from Yao et al., 2010
otolith decreased size, abnormal AB + MO1-grhl2b + MO5-tp53 standard conditions Fig. 3 from Han et al., 2011
post-vent region curved ventral, abnormal AB + MO1-rer1 + MO5-tp53 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
whole organism anterior-posterior axis bent, abnormal AB + MO1-rer1 + MO5-tp53 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
somite border deformed, abnormal AB + MO2-atoh8 + MO5-tp53 standard conditions Fig. 5 with image from Yao et al., 2010
blood circulation disrupted, abnormal AB + MO2-atoh8 + MO5-tp53 standard conditions Fig. 5 with image from Yao et al., 2010
post-vent region decreased flexibility, abnormal AB + MO2-atoh8 + MO5-tp53 standard conditions Fig. 5 with image from Yao et al., 2010
extension decreased length, abnormal AB + MO2-atoh8 + MO5-tp53 standard conditions Fig. 5 with image from Yao et al., 2010
pharyngeal arch 3-7 decreased size, abnormal AB + MO2-atoh8 + MO5-tp53 standard conditions Fig. 5 with image from Yao et al., 2010
whole organism anterior-posterior axis curved ventral, abnormal AB + MO2-atoh8 + MO5-tp53 standard conditions Fig. 5 with image from Yao et al., 2010
eye decreased size, abnormal AB + MO2-atoh8 + MO5-tp53 standard conditions Fig. 5 with image from Yao et al., 2010
head hypotrophic, abnormal AB + MO2-atoh8 + MO5-tp53 standard conditions Fig. 5 with image from Yao et al., 2010
brain shape, abnormal AB + MO2-atoh8 + MO5-tp53 standard conditions Fig. 5 with image from Yao et al., 2010
somite fused with somite, abnormal AB + MO2-atoh8 + MO5-tp53 standard conditions Fig. 5 with image from Yao et al., 2010
somite U-shaped, abnormal AB + MO2-atoh8 + MO5-tp53 standard conditions Fig. 5 with image from Yao et al., 2010
whole organism anterior-posterior axis bent, abnormal AB + MO3-rer1 + MO5-tp53 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
post-vent region curved ventral, abnormal AB + MO3-rer1 + MO5-tp53 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
whole organism col15a1b expression decreased amount, abnormal AB/TU + MO3-col15a1b + MO5-tp53 standard conditions Fig. 6 from Guillon et al., 2016
dorsal/ventral pattern formation disrupted, abnormal TU + MO1-fbxl15 + MO5-tp53 standard conditions Fig. 7 from Cui et al., 2011
trunk decreased length, abnormal TU + MO1-fbxl15 + MO5-tp53 standard conditions Fig. 7 from Cui et al., 2011
trunk increased curvature, abnormal TU + MO1-fbxl15 + MO5-tp53 standard conditions Fig. 7 from Cui et al., 2011
whole organism wholly dorsalized, abnormal TU + MO1-fbxl15 + MO5-tp53 standard conditions Fig. 7 from Cui et al., 2011
granulocyte decreased amount, abnormal TU + MO5-etv5a + MO5-tp53 standard conditions Fig. 2 from Chen et al., 2013
hematopoietic stem cell differentiation disrupted, abnormal TU + MO5-etv5a + MO5-tp53 standard conditions Fig. 2 from Chen et al., 2013
hematopoietic stem cell decreased amount, abnormal TU + MO5-etv5a + MO5-tp53 standard conditions Fig. 2 from Chen et al., 2013
erythroid lineage cell decreased amount, abnormal TU + MO5-etv5a + MO5-tp53 standard conditions Fig. 2 from Chen et al., 2013
hemopoiesis disrupted, abnormal TU + MO5-etv5a + MO5-tp53 standard conditions Fig. 2 from Chen et al., 2013
hemangioblast cell differentiation disrupted, abnormal TU + MO5-etv5a + MO5-tp53 standard conditions Fig. 2 from Chen et al., 2013
common lymphoid progenitor decreased amount, abnormal TU + MO5-etv5a + MO5-tp53 standard conditions Fig. 2 from Chen et al., 2013
skeletal muscle refractivity, abnormal WIK + MO1-hspb9l + MO5-tp53 standard conditions Figure 6 with image from Klüver et al., 2011
slow muscle cell myosin filament disorganized, abnormal WIK + MO1-hspb9l + MO5-tp53 standard conditions Figure 6 with image from Klüver et al., 2011
skeletal muscle refractivity, abnormal WIK + MO2-hspb9l + MO5-tp53 standard conditions Figure 6 with image from Klüver et al., 2011
slow muscle cell myosin filament disorganized, abnormal WIK + MO2-hspb9l + MO5-tp53 standard conditions Figure 6 with image from Klüver et al., 2011
whole organism sod1 expression decreased amount, abnormal WT + MO1-atp7a + MO5-tp53 standard conditions Fig. 1 from Chen et al., 2011
head apoptotic, abnormal WT + MO1-cenph + MO2-cenph + MO5-tp53 standard conditions Fig. 3 from Zhao et al., 2010
spinal cord opaque, abnormal WT + MO1-cenph + MO2-cenph + MO5-tp53 standard conditions Fig. 3 from Zhao et al., 2010
integument rough, abnormal WT + MO1-cenph + MO2-cenph + MO5-tp53 standard conditions Fig. 3 from Zhao et al., 2010
trunk curved dorsal, abnormal WT + MO1-cenph + MO2-cenph + MO5-tp53 standard conditions Fig. 3 from Zhao et al., 2010
spinal cord apoptotic, abnormal WT + MO1-cenph + MO2-cenph + MO5-tp53 standard conditions Fig. 3 from Zhao et al., 2010
head opaque, abnormal WT + MO1-cenph + MO2-cenph + MO5-tp53 standard conditions Fig. 3 from Zhao et al., 2010
eye decreased size, abnormal WT + MO1-cenph + MO2-cenph + MO5-tp53 standard conditions Fig. 3 from Zhao et al., 2010
roof of mouth development disrupted, abnormal WT + MO1-faf1 + MO5-tp53 standard conditions Fig. 2 from Ghassibe-Sabbagh et al., 2011
mouth open, abnormal WT + MO1-faf1 + MO5-tp53 standard conditions Fig. 2 from Ghassibe-Sabbagh et al., 2011
neural tube morphology, abnormal WT + MO1-fbxl18 + MO5-tp53 standard conditions Fig. 5 from Lee et al., 2017
sclerotome structure, abnormal WT + MO1-fbxl18 + MO5-tp53 standard conditions Fig. 5 from Lee et al., 2017
trunk truncated, abnormal WT + MO1-iqgap3 + MO5-tp53 standard conditions Fig. 5 from Fang et al., 2015
somite shape, abnormal WT + MO1-iqgap3 + MO5-tp53 standard conditions Fig. 5 from Fang et al., 2015
somite increased size, abnormal WT + MO1-iqgap3 + MO5-tp53 standard conditions Fig. 5 from Fang et al., 2015
whole organism anterior-posterior axis truncated, abnormal WT + MO1-iqgap3 + MO5-tp53 standard conditions Fig. 5 from Fang et al., 2015
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-iqgap3 + MO5-tp53 standard conditions Fig. 5 from Fang et al., 2015
whole organism anterior-posterior axis increased width, abnormal WT + MO1-iqgap3 + MO5-tp53 standard conditions Fig. 5 from Fang et al., 2015
caudal fin curved, abnormal WT + MO1-ppp4cb + MO5-tp53 standard conditions Fig. 1 with image from Jia et al., 2012
trunk posterior region decreased size, abnormal WT + MO1-ppp4cb + MO5-tp53 standard conditions Fig. 1 with image from Jia et al., 2012
caudal fin decreased thickness, abnormal WT + MO1-ppp4cb + MO5-tp53 standard conditions Fig. 1 with image from Jia et al., 2012
whole organism wholly dorsalized, abnormal WT + MO1-ppp4cb + MO5-tp53 standard conditions Fig. 1 with image from Jia et al., 2012
tail bud malformed, exacerbated WT + MO1-txnb + MO5-tp53 chemical treatment by environment: methylmercury chloride Fig. 5 from Yang et al., 2019
ventricular system hydrocephalic, exacerbated WT + MO1-txnb + MO5-tp53 chemical treatment by environment: methylmercury chloride Fig. 5 from Yang et al., 2019
midbrain decreased size, abnormal WT + MO1-txnb + MO5-tp53 control Fig. 4 from Yang et al., 2019
third ventricle hydrocephalic, abnormal WT + MO1-txnb + MO5-tp53 control Fig. 4 from Yang et al., 2019
ventricular zone apoptotic process increased occurrence, abnormal WT + MO1-txnb + MO5-tp53 control Fig. 4 from Yang et al., 2019
fin malformed, exacerbated WT + MO1-txnb + MO5-tp53 chemical treatment by environment: methylmercury chloride Fig. 5 from Yang et al., 2019
ventricular system hydrocephalic, abnormal WT + MO1-txnb + MO5-tp53 control Fig. 4 from Yang et al., 2019
midbrain hindbrain boundary malformed, abnormal WT + MO1-txnb + MO5-tp53 control Fig. 4 from Yang et al., 2019
medulla oblongata decreased size, abnormal WT + MO1-txnb + MO5-tp53 control Fig. 4 from Yang et al., 2019
pericardium edematous, exacerbated WT + MO1-txnb + MO5-tp53 chemical treatment by environment: methylmercury chloride Fig. 5 from Yang et al., 2019
mouth open, abnormal WT + MO2-faf1 + MO5-tp53 standard conditions Fig. 2 from Ghassibe-Sabbagh et al., 2011
roof of mouth development disrupted, abnormal WT + MO2-faf1 + MO5-tp53 standard conditions Fig. 2 from Ghassibe-Sabbagh et al., 2011
whole organism decreased length, abnormal WT + MO2-loxa + MO5-tp53 standard conditions Fig. 4 from Reynaud et al., 2008
whole organism morphology, abnormal WT + MO2-loxa + MO5-tp53 standard conditions Fig. 4 from Reynaud et al., 2008
optic tectum structure, abnormal WT + MO2-mmp2 + MO5-tp53 standard conditions Fig. S2 with image from Janssens et al., 2013
retinal ganglion cell axon guidance disrupted, abnormal WT + MO2-mmp2 + MO5-tp53 standard conditions Fig. S2 with image from Janssens et al., 2013
eye decreased diameter, abnormal WT + MO2-mmp2 + MO5-tp53 standard conditions Fig. S2 with image from Janssens et al., 2013
whole organism decreased length, abnormal WT + MO2-mmp2 + MO5-tp53 standard conditions Fig. S2 with image from Janssens et al., 2013
whole organism wholly dorsalized, abnormal WT + MO2-ppp4cb + MO5-tp53 standard conditions Fig. 1 with image from Jia et al., 2012
caudal fin curved, abnormal WT + MO2-ppp4cb + MO5-tp53 standard conditions Fig. 1 with image from Jia et al., 2012
trunk posterior region decreased size, abnormal WT + MO2-ppp4cb + MO5-tp53 standard conditions Fig. 1 with image from Jia et al., 2012
caudal fin decreased thickness, abnormal WT + MO2-ppp4cb + MO5-tp53 standard conditions Fig. 1 with image from Jia et al., 2012
yolk swollen, abnormal WT + MO2-prmt8b + MO5-tp53 standard conditions Fig. S1 with image from Lin et al., 2013
brain malformed, abnormal WT + MO2-prmt8b + MO5-tp53 standard conditions Fig. S1 with image from Lin et al., 2013
eye decreased size, abnormal WT + MO2-prmt8b + MO5-tp53 standard conditions Fig. S1 with image from Lin et al., 2013
heart edematous, abnormal WT + MO2-prmt8b + MO5-tp53 standard conditions Fig. S1 with image from Lin et al., 2013
post-vent region curved, abnormal WT + MO2-prmt8b + MO5-tp53 standard conditions Fig. S1 with image from Lin et al., 2013
neural tube morphology, abnormal WT + MO2-tgfb2 + MO5-tp53 standard conditions Fig. 5 from Lee et al., 2017
sclerotome structure, abnormal WT + MO2-tgfb2 + MO5-tp53 standard conditions Fig. 5 from Lee et al., 2017
neural tube morphology, abnormal WT + MO2-tle3a + MO5-tp53 standard conditions Fig. 5 from Lee et al., 2017
sclerotome structure, abnormal WT + MO2-tle3a + MO5-tp53 standard conditions Fig. 5 from Lee et al., 2017
trunk posterior region decreased size, abnormal WT + MO3-ppp4ca + MO5-tp53 standard conditions Fig. 1 with image from Jia et al., 2012
caudal fin decreased thickness, abnormal WT + MO3-ppp4ca + MO5-tp53 standard conditions Fig. 1 with image from Jia et al., 2012
caudal fin curved, abnormal WT + MO3-ppp4ca + MO5-tp53 standard conditions Fig. 1 with image from Jia et al., 2012
whole organism wholly dorsalized, abnormal WT + MO3-ppp4ca + MO5-tp53 standard conditions Fig. 1 with image from Jia et al., 2012
retinal ganglion cell decreased amount, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 6 with image from Janssens et al., 2013
retinal ganglion cell axon guidance disrupted, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 8 with image from Janssens et al., 2013
retina layer formation disrupted, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 6 with image from Janssens et al., 2013
retina has fewer parts of type amacrine cell, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 6 with image from Janssens et al., 2013
cranial nerve II hypoplastic, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 6 with image from Janssens et al., 2013
cell proliferation involved in compound eye morphogenesis increased occurrence, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 7 with image from Janssens et al., 2013
neural retina development delayed, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 6 with image from Janssens et al., 2013
retina lacks all parts of type amacrine cell, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 6 with image from Janssens et al., 2013
Muller cell decreased amount, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 6 with image from Janssens et al., 2013
Meckel's cartilage malformed, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 4 with image from Janssens et al., 2013
retina layer formation delayed, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 6 with image from Janssens et al., 2013
eye decreased size, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 5 with image from Janssens et al., 2013
retina morphology, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 6 with image from Janssens et al., 2013
ciliary marginal zone increased size, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 7 with image from Janssens et al., 2013
ceratohyal cartilage malformed, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 4 with image from Janssens et al., 2013
retina proliferative region increased size, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 7 with image from Janssens et al., 2013
retinal cone cell decreased amount, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 6 with image from Janssens et al., 2013
eye decreased diameter, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 5 with image,  Fig. 9 with image from Janssens et al., 2013
caudal fin decreased thickness, abnormal WT + MO4-ppp4ca + MO5-tp53 standard conditions Fig. 1 with image from Jia et al., 2012
trunk posterior region decreased size, abnormal WT + MO4-ppp4ca + MO5-tp53 standard conditions Fig. 1 with image from Jia et al., 2012
caudal fin curved, abnormal WT + MO4-ppp4ca + MO5-tp53 standard conditions Fig. 1 with image from Jia et al., 2012
whole organism wholly dorsalized, abnormal WT + MO4-ppp4ca + MO5-tp53 standard conditions Fig. 1 with image from Jia et al., 2012
eye decreased size, abnormal WT + MO5-mmp14a + MO5-tp53 standard conditions Fig. 5 with image from Janssens et al., 2013
eye decreased diameter, abnormal WT + MO5-mmp14a + MO5-tp53 standard conditions Fig. 5 with image from Janssens et al., 2013
cranial nerve II decreased thickness, abnormal rw021Tg + MO4-mmp14a + MO5-tp53 standard conditions Fig. 8 with image from Janssens et al., 2013
neural retina development delayed, abnormal rw021Tg + MO4-mmp14a + MO5-tp53 standard conditions Fig. 7 with image from Janssens et al., 2013
neural retina development delayed, abnormal rw021Tg + MO5-mmp14a + MO5-tp53 standard conditions Fig. 7 with image from Janssens et al., 2013
neural crest cell migration disrupted, abnormal y1Tg + MO1-faf1 + MO5-tp53 standard conditions Fig. 2 from Ghassibe-Sabbagh et al., 2011
pharyngeal arch cranial neural crest mislocalised, abnormal y1Tg + MO1-faf1 + MO5-tp53 standard conditions Fig. 2 from Ghassibe-Sabbagh et al., 2011
neural crest cell migration disrupted, abnormal y1Tg + MO2-faf1 + MO5-tp53 standard conditions Fig. 2 from Ghassibe-Sabbagh et al., 2011
pharyngeal arch cranial neural crest mislocalised, abnormal y1Tg + MO2-faf1 + MO5-tp53 standard conditions Fig. 2 from Ghassibe-Sabbagh et al., 2011
posterior lateral line neuromast decreased amount, abnormal zf106Tg + MO1-smad5 + MO5-tp53 standard conditions Fig. 5 from Xing et al., 2015
posterior lateral line neuromast far from posterior lateral line neuromast, abnormal zf106Tg + MO1-smad5 + MO5-tp53 standard conditions Fig. 5 from Xing et al., 2015
posterior lateral line neuromast far from posterior lateral line neuromast, abnormal zf106Tg + MO4-tgfb1a + MO5-tp53 standard conditions Fig. 1 from Xing et al., 2015
posterior lateral line neuromast decreased amount, abnormal zf106Tg + MO4-tgfb1a + MO5-tp53 standard conditions Fig. 1 from Xing et al., 2015
posterior lateral line neuromast irregular spatial pattern, abnormal zf106Tg + MO4-tgfb1a + MO5-tp53 standard conditions Fig. 1 from Xing et al., 2015
head apoptotic, abnormal cenphtsu055Gt/tsu055Gt + MO5-tp53 standard conditions Fig. 5 from Zhao et al., 2010
trunk curved dorsal, abnormal cenphtsu055Gt/tsu055Gt + MO5-tp53 standard conditions Fig. 5 from Zhao et al., 2010
brain apoptotic, abnormal cenphtsu055Gt/tsu055Gt + MO5-tp53 standard conditions Fig. 5 from Zhao et al., 2010
spinal cord opaque, abnormal cenphtsu055Gt/tsu055Gt + MO5-tp53 standard conditions Fig. 5 from Zhao et al., 2010
eye decreased size, abnormal cenphtsu055Gt/tsu055Gt + MO5-tp53 standard conditions Fig. 5 from Zhao et al., 2010
head opaque, abnormal cenphtsu055Gt/tsu055Gt + MO5-tp53 standard conditions Fig. 5 from Zhao et al., 2010
spinal cord apoptotic, abnormal cenphtsu055Gt/tsu055Gt + MO5-tp53 standard conditions Fig. 5 from Zhao et al., 2010
vasculature hemorrhagic, abnormal gbf1tsu3994/tsu3994 + MO5-tp53 standard conditions Fig. 9 from Chen et al., 2017
eye decreased diameter, abnormal WT + MO1-mmp14b + MO4-mmp14a + MO5-tp53 standard conditions Fig. 9 with image from Janssens et al., 2013
retinal ganglion cell axon guidance disrupted, abnormal WT + MO2-mmp2 + MO4-mmp14a + MO5-tp53 standard conditions Fig. 10 with image from Janssens et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.