Morpholino

MO1-cdh2

ID
ZDB-MRPHLNO-060815-1
Name
MO1-cdh2
Previous Names
  • N-cad MO (1)
  • ncad-MO1 (1)
Target
Sequence
5' - TCTGTATAAAGAAACCGATAGAGTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cdh2
No data available
Phenotype
Phenotype resulting from MO1-cdh2
Phenotype Fish Figures
branchiomotor neuron decreased cellular motility, abnormal ch100Tg + MO1-cdh2 Fig. 6 with image,  Fig. 7 with image,  Fig. 8 with image from Wanner et al., 2013
branchiomotor neuron detached from medial longitudinal fasciculus, abnormal ch100Tg + MO1-cdh2 Fig. 8 with image from Wanner et al., 2013
branchiomotor neuron neuron migration decreased velocity, abnormal ch100Tg; knu3Tg + MO1-cdh2 Fig. 6 with image,  Fig. 7 with image,  Fig. 8 with image from Wanner et al., 2013
epiphysis split, abnormal WT + MO1-cdh2 Fig. 4 with image from Aquilina-Beck et al., 2007
fourth ventricle increased size, abnormal WT + MO1-cdh2 Fig. 3 with image from Lele et al., 2002
hindbrain disorganized, abnormal WT + MO1-cdh2 Fig. 3 with image from Lele et al., 2002
hindbrain neural tube ptch2 expression increased distribution, abnormal TL + MO1-cdh2 Fig. 4 from Chalasani et al., 2011
hindbrain neural tube gli2a expression increased distribution, abnormal TL + MO1-cdh2 Fig. 4 from Chalasani et al., 2011
hindbrain neural tube gli1 expression increased distribution, abnormal TL + MO1-cdh2 Fig. 4 from Chalasani et al., 2011
intersegmental vessel malformed, abnormal sd2Tg; y1Tg + MO1-cdh2 Fig. 6 from Agarwal et al., 2014
midbrain disorganized, abnormal WT + MO1-cdh2 Fig. 3 with image from Lele et al., 2002
neuroepithelial cell displaced to fourth ventricle, abnormal WT + MO1-cdh2 Fig. 3 with image from Lele et al., 2002
neuron cell-cell adhesion disrupted, abnormal ch100Tg + MO1-cdh2 Fig. 7 with image,  Fig. 8 with image from Wanner et al., 2013
posterior lateral line neuromast decreased amount, abnormal zf106Tg + MO1-cdh2 Fig. 3 from Xing et al., 2015
posterior lateral line neuromast far from posterior lateral line neuromast, abnormal zf106Tg + MO1-cdh2 Fig. 3 from Xing et al., 2015
posterior neural tube T-shaped, abnormal WT + MO1-cdh2 Fig. S1 with image from Harrington et al., 2007
smoothened signaling pathway increased process quality, abnormal TL + MO1-cdh2 Fig. 4 from Chalasani et al., 2011
whole organism morphology, abnormal cdh2tb8/+ + MO1-cdh2 Fig. 4 with image from Warga et al., 2007
Phenotype of all Fish created by or utilizing MO1-cdh2
Phenotype Fish Conditions Figures
whole organism morphology, abnormal cdh2tb8/tb8 + MO1-cdh2 standard conditions Fig. 4 with image from Warga et al., 2007
hindbrain neural tube gli2a expression increased distribution, abnormal TL + MO1-cdh2 standard conditions Fig. 4 from Chalasani et al., 2011
hindbrain neural tube gli1 expression increased distribution, abnormal TL + MO1-cdh2 standard conditions Fig. 4 from Chalasani et al., 2011
smoothened signaling pathway increased process quality, abnormal TL + MO1-cdh2 standard conditions Fig. 4 from Chalasani et al., 2011
hindbrain neural tube ptch2 expression increased distribution, abnormal TL + MO1-cdh2 standard conditions Fig. 4 from Chalasani et al., 2011
posterior neural tube T-shaped, abnormal WT + MO1-cdh2 standard conditions Fig. S1 with image from Harrington et al., 2007
epiphysis split, abnormal WT + MO1-cdh2 standard conditions Fig. 4 with image from Aquilina-Beck et al., 2007
neuroepithelial cell displaced to fourth ventricle, abnormal WT + MO1-cdh2 standard conditions Fig. 3 with image from Lele et al., 2002
hindbrain disorganized, abnormal WT + MO1-cdh2 standard conditions Fig. 3 with image from Lele et al., 2002
midbrain disorganized, abnormal WT + MO1-cdh2 standard conditions Fig. 3 with image from Lele et al., 2002
fourth ventricle increased size, abnormal WT + MO1-cdh2 standard conditions Fig. 3 with image from Lele et al., 2002
pectoral fin bud cartilage element disorganized, abnormal WT + MO1-cdh2 + MO2-cdh2 standard conditions Fig. 4 with image from Liu et al., 2003
cranial nerve II defasciculated, abnormal WT + MO1-cdh2 + MO2-cdh2 standard conditions Fig. 3 with image from Liu et al., 2003
midbrain disorganized, abnormal WT + MO1-cdh2 + MO2-cdh2 standard conditions Fig. 3 with image from Liu et al., 2003
pectoral fin development disrupted, abnormal WT + MO1-cdh2 + MO2-cdh2 standard conditions Fig. 3 with image,  Fig. 4 with image from Liu et al., 2003
fourth ventricle cell mislocalised, abnormal WT + MO1-cdh2 + MO2-cdh2 standard conditions Fig. 3 with image from Liu et al., 2003
hair cell posterior macula kinocilium decreased length, abnormal WT + MO1-cdh2 + MO2-cdh2 standard conditions Fig. 1 from Babb-Clendenon et al., 2006
hindbrain disorganized, abnormal WT + MO1-cdh2 + MO2-cdh2 standard conditions Fig. 3 with image from Liu et al., 2003
semicircular canal aplastic, abnormal WT + MO1-cdh2 + MO2-cdh2 standard conditions Fig. 5 from Babb-Clendenon et al., 2006
hair cell anterior macula kinocilium decreased length, abnormal WT + MO1-cdh2 + MO2-cdh2 standard conditions Fig. 1 from Babb-Clendenon et al., 2006
pectoral fin bud cartilage element absent, abnormal WT + MO1-cdh2 + MO2-cdh2 standard conditions Fig. 4 with image from Liu et al., 2003
hair cell posterior macula stereocilium bundle decreased length, abnormal WT + MO1-cdh2 + MO2-cdh2 standard conditions Fig. 5 from Babb-Clendenon et al., 2006
fourth ventricle increased size, abnormal WT + MO1-cdh2 + MO2-cdh2 standard conditions Fig. 3 with image from Liu et al., 2003
midbrain fourth ventricle mislocalised anteriorly, abnormal WT + MO1-cdh2 + MO2-cdh2 standard conditions Fig. 3 with image from Liu et al., 2003
whole organism morphology, abnormal cdh2tb8/+ + MO1-cdh2 standard conditions Fig. 4 with image from Warga et al., 2007
branchiomotor neuron detached from medial longitudinal fasciculus, abnormal ch100Tg + MO1-cdh2 standard conditions Fig. 8 with image from Wanner et al., 2013
neuron cell-cell adhesion disrupted, abnormal ch100Tg + MO1-cdh2 standard conditions Fig. 7 with image,  Fig. 8 with image from Wanner et al., 2013
branchiomotor neuron decreased cellular motility, abnormal ch100Tg + MO1-cdh2 standard conditions Fig. 7 with image,  Fig. 8 with image from Wanner et al., 2013
branchiomotor neuron neuron migration decreased velocity, abnormal ch100Tg + MO1-cdh2 standard conditions Fig. 7 with image,  Fig. 8 with image from Wanner et al., 2013
posterior lateral line neuromast far from posterior lateral line neuromast, abnormal zf106Tg + MO1-cdh2 standard conditions Fig. 3 from Xing et al., 2015
posterior lateral line neuromast decreased amount, abnormal zf106Tg + MO1-cdh2 standard conditions Fig. 3 from Xing et al., 2015
branchiomotor neuron neuron migration decreased velocity, abnormal ch100Tg; knu3Tg + MO1-cdh2 standard conditions Fig. 6 with image from Wanner et al., 2013
branchiomotor neuron decreased cellular motility, abnormal ch100Tg; knu3Tg + MO1-cdh2 standard conditions Fig. 6 with image from Wanner et al., 2013
intersegmental vessel malformed, abnormal sd2Tg; y1Tg + MO1-cdh2 chemical treatment: ligand Fig. 6 from Agarwal et al., 2014
intersegmental vessel malformed, abnormal sd2Tg; y1Tg + MO1-cdh2 standard conditions Fig. 6 from Agarwal et al., 2014
dorsal convergence disrupted, abnormal WT + MO1-cdh2 + MO1-chrd standard conditions Fig. 6 with image from von der Hardt et al., 2007
lateral mesoderm mislocalised, abnormal WT + MO1-cdh2 + MO1-chrd standard conditions Fig. 6 with image from von der Hardt et al., 2007
axis melanoblast mislocalised medially, abnormal WT + MO1-cdh2 + MO2-ovol1a standard conditions Fig. 4 with image from Piloto et al., 2010
whole organism has extra parts of type post-vent region, abnormal WT + MO1-cdh2 + MO2-tll1 standard conditions Fig. 5 with image from Yang et al., 2011
notochord morphogenesis disrupted, abnormal WT + MO1-cdh2 + MO2-tll1 standard conditions Fig. 5 with image from Yang et al., 2011
post-anal tail morphogenesis disrupted, abnormal WT + MO1-cdh2 + MO2-tll1 standard conditions Fig. 5 with image from Yang et al., 2011
post-vent region deformed, abnormal WT + MO1-cdh2 + MO2-tll1 standard conditions Fig. 5 with image from Yang et al., 2011
post-anal tail morphogenesis having extra processual parts post-anal tail morphogenesis, abnormal WT + MO1-cdh2 + MO2-tll1 standard conditions Fig. 5 with image from Yang et al., 2011
post-anal tail morphogenesis disrupted, abnormal WT + MO1-cdh2 + MO1-dvl2 + MO1-dvl3a standard conditions Fig. 5 with image from Yang et al., 2011
post-anal tail morphogenesis having extra processual parts post-anal tail morphogenesis, abnormal WT + MO1-cdh2 + MO1-dvl2 + MO1-dvl3a standard conditions Fig. 5 with image from Yang et al., 2011
whole organism has extra parts of type post-vent region, abnormal WT + MO1-cdh2 + MO1-dvl2 + MO1-dvl3a standard conditions Fig. 5 with image from Yang et al., 2011
post-vent region deformed, abnormal WT + MO1-cdh2 + MO1-dvl2 + MO1-dvl3a standard conditions Fig. 5 with image from Yang et al., 2011
neuroepithelial cell catenin complex spatial pattern, abnormal ctnna1ct3aGt + MO1-cdh2 standard conditions Fig. 3 with image from Zigman et al., 2011
establishment of mitotic spindle orientation decreased process quality, abnormal ctnna1ct3aGt + MO1-cdh2 standard conditions Fig. 3 with image from Zigman et al., 2011
neural plate EGFP expression spatial pattern, abnormal e2212Tg + MO1-cdh2 standard conditions Figure 7 with image from Araya et al., 2019
neural keel formation process quality, abnormal e2212Tg + MO1-cdh2 standard conditions Figure 7 with image from Araya et al., 2019
neural plate dorsal convergence process quality, abnormal e2212Tg + MO1-cdh2 standard conditions Figure 7 with image from Araya et al., 2019
hindbrain cell adhesion decreased efficacy, abnormal gbx1tud48Tg + MO1-cdh2 chemical treatment by environment: ethylene glycol bis(2-aminoethyl)tetraacetic acid Fig. 5 with image from Kesavan et al., 2020
midbrain cell adhesion decreased efficacy, abnormal gbx1tud48Tg + MO1-cdh2 chemical treatment by environment: ethylene glycol bis(2-aminoethyl)tetraacetic acid Fig. 5 with image from Kesavan et al., 2020
hindbrain cell adhesion decreased efficacy, abnormal otx2btud40Tg + MO1-cdh2 chemical treatment by environment: ethylene glycol bis(2-aminoethyl)tetraacetic acid Fig. 5 with image from Kesavan et al., 2020
midbrain cell adhesion decreased efficacy, abnormal otx2btud40Tg + MO1-cdh2 standard conditions Fig. 5 with image from Kesavan et al., 2020
midbrain cell adhesion decreased efficacy, abnormal otx2btud40Tg + MO1-cdh2 chemical treatment by environment: ethylene glycol bis(2-aminoethyl)tetraacetic acid Fig. 5 with image from Kesavan et al., 2020
lens epithelium cell migration process quality, abnormal kca66Tg; kca6Tg; oki011Tg + MO1-cdh2 control Fig. 2,  Fig. 4 with image from Mochizuki et al., 2017
lens epithelium tension, abnormal kca66Tg; kca6Tg; oki011Tg + MO1-cdh2 light ablation: lens epithelium Fig. 5 with image from Mochizuki et al., 2017
lens epithelium cell migration process quality, abnormal kca66Tg; kca6Tg; oki011Tg + MO1-cdh2 light ablation: lens epithelium Fig. 5 with image from Mochizuki et al., 2017
Citations