Morpholino

MO1-gata5

ID
ZDB-MRPHLNO-060522-2
Name
MO1-gata5
Previous Names
None
Target
Sequence
5' - TGTTAAGATTTTTACCTATACTGGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The sequence in Trinh et al. 2005 (ZDB-PUB-060517-17) contains a typo. The corrected sequence is displayed on this page.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gata5
Phenotype
Phenotype resulting from MO1-gata5
Phenotype Fish Figures
anterior lateral plate mesoderm nkx2.5 expression decreased amount, abnormal WT + MO1-gata5 Fig. 4 from Wen et al., 2017
anterior lateral plate mesoderm myocardial precursor myh7 expression decreased amount, abnormal WT + MO1-gata5 Fig. 4 from Wen et al., 2017
anterior lateral plate mesoderm myocardial precursor myl7 expression decreased amount, abnormal WT + MO1-gata5 Fig. 4 from Wen et al., 2017
embryonic heart tube development disrupted, abnormal WT + MO1-gata5 Fig. 4 with imageFig. 5 with image from Peterkin et al., 2007
heart bifurcated, abnormal knu9Tg + MO1-gata5(AB) Fig. 6 with image from Park et al., 2009
Fig. 1 with image from Holtzinger et al., 2007
heart decreased size, abnormal WT + MO1-gata5 Fig. 5 from Jia et al., 2007
heart nppa expression increased distribution, abnormal WT + MO1-gata5 Fig. 4 from Wen et al., 2017
heart morphology, abnormal WT + MO1-gata5 Fig. 4 from Wen et al., 2017
heart physical object quality, abnormal WT + MO1-gata5 Fig. 1 with image from Holtzinger et al., 2007
heart nppa expression spatial pattern, abnormal WT + MO1-gata5 Fig. 4 from Wen et al., 2017
heart cardiac muscle cell decreased amount, abnormal WT + MO1-gata5 Fig. 5 from Jia et al., 2007
heart morphogenesis disrupted, abnormal WT + MO1-gata5 Fig. 4 with imageFig. 5 with image from Peterkin et al., 2007
heart morphogenesis process quality, abnormal knu9Tg + MO1-gata5(AB) Fig. 6 with image from Park et al., 2009
heart primordium left side unfused from heart primordium right side, abnormal WT + MO1-gata5 Fig. 1 with image from Holtzinger et al., 2007
heart rudiment bifurcated, abnormal WT + MO1-gata5 Fig. 2 from Hempel et al., 2017
heart rudiment morphology, abnormal WT + MO1-gata5 Fig. 2 from Hempel et al., 2017
heart tube malformed, abnormal WT + MO1-gata5 Fig. 4 with imageFig. 5 with image from Peterkin et al., 2007
Phenotype of all Fish created by or utilizing MO1-gata5
Phenotype Fish Conditions Figures
heart rudiment morphology, abnormal WT + MO1-gata5 standard conditions Fig. 2 from Hempel et al., 2017
heart physical object quality, abnormal WT + MO1-gata5 standard conditions Fig. 1 with image from Holtzinger et al., 2007
heart cardiac muscle cell decreased amount, abnormal WT + MO1-gata5 standard conditions Fig. 5 from Jia et al., 2007
heart tube malformed, abnormal WT + MO1-gata5 standard conditions Fig. 4 with imageFig. 5 with image from Peterkin et al., 2007
anterior lateral plate mesoderm nkx2.5 expression decreased amount, abnormal WT + MO1-gata5 standard conditions Fig. 4 from Wen et al., 2017
heart morphology, abnormal WT + MO1-gata5 standard conditions Fig. 4 from Wen et al., 2017
heart primordium left side unfused from heart primordium right side, abnormal WT + MO1-gata5 standard conditions Fig. 1 with image from Holtzinger et al., 2007
anterior lateral plate mesoderm myocardial precursor myl7 expression decreased amount, abnormal WT + MO1-gata5 standard conditions Fig. 4 from Wen et al., 2017
heart bifurcated, abnormal WT + MO1-gata5 standard conditions Fig. 1 with image from Holtzinger et al., 2007
heart rudiment bifurcated, abnormal WT + MO1-gata5 standard conditions Fig. 2 from Hempel et al., 2017
embryonic heart tube development disrupted, abnormal WT + MO1-gata5 standard conditions Fig. 4 with imageFig. 5 with image from Peterkin et al., 2007
heart nppa expression spatial pattern, abnormal WT + MO1-gata5 standard conditions Fig. 4 from Wen et al., 2017
heart decreased size, abnormal WT + MO1-gata5 standard conditions Fig. 5 from Jia et al., 2007
anterior lateral plate mesoderm myocardial precursor myh7 expression decreased amount, abnormal WT + MO1-gata5 standard conditions Fig. 4 from Wen et al., 2017
heart morphogenesis disrupted, abnormal WT + MO1-gata5 standard conditions Fig. 4 with imageFig. 5 with image from Peterkin et al., 2007
heart nppa expression increased distribution, abnormal WT + MO1-gata5 standard conditions Fig. 4 from Wen et al., 2017
heart duplicated, abnormal cy13Tg + MO1-gata5 standard conditions Fig. 3 with image from Lin et al., 2013
heart morphogenesis process quality, abnormal knu9Tg + MO1-gata5(AB) standard conditions Fig. 6 with image from Park et al., 2009
heart bifurcated, abnormal knu9Tg + MO1-gata5(AB) standard conditions Fig. 6 with image from Park et al., 2009
heart cardiac muscle cell decreased amount, abnormal hey2m145/m145 + MO1-gata5 standard conditions Fig. 5 from Jia et al., 2007
heart decreased size, abnormal hey2m145/m145 + MO1-gata5 standard conditions Fig. 5 from Jia et al., 2007
heart morphogenesis disrupted, abnormal WT + MO1-gata5 + MO1-gata6 standard conditions Fig. 4 with imageFig. 5 with image from Peterkin et al., 2007
heart formation disrupted, abnormal WT + MO1-gata5 + MO1-gata6 standard conditions Fig. 3 with image from Peterkin et al., 2009
fin bud aplastic, abnormal WT + MO1-gata5 + MO1-gata6 standard conditions Fig. 6 with image from Peterkin et al., 2009
whole organism mir210 expression increased amount, abnormal WT + MO1-gata5 + MO1-gata6 standard conditions Fig. 2 from Jia et al., 2018
cardioblast migration to the midline involved in heart field formation disrupted, abnormal WT + MO1-gata5 + MO1-gata6 standard conditions Fig. 3 with image from Peterkin et al., 2009
myeloid cell differentiation decreased occurrence, abnormal WT + MO1-gata5 + MO1-gata6 standard conditions Fig. 3 from Jia et al., 2018
otic placode foxj1b expression decreased amount, abnormal WT + MO1-gata5 + MO1-gata6 standard conditions Fig. S3 from Jia et al., 2018
embryonic heart tube development disrupted, abnormal WT + MO1-gata5 + MO1-gata6 standard conditions Fig. 4 with imageFig. 5 with image from Peterkin et al., 2007
yolk syncytial layer slc3a2a expression decreased amount, abnormal WT + MO1-gata5 + MO1-gata6 standard conditions Fig. S3 from Jia et al., 2018
granulocyte mpx expression decreased amount, abnormal WT + MO1-gata5 + MO1-gata6 standard conditions Fig. 3 from Jia et al., 2018
myeloid cell differentiation disrupted, abnormal WT + MO1-gata5 + MO1-gata6 standard conditions Fig. 1 with image from Peterkin et al., 2009
heart tube malformed, abnormal WT + MO1-gata5 + MO1-gata6 standard conditions Fig. 4 with imageFig. 5 with image from Peterkin et al., 2007
heart morphogenesis disrupted, abnormal WT + MO1-gata5 + MO1-smarcd3b standard conditions Fig. 1 with image from Lou et al., 2011
heart tube bifurcated, abnormal WT + MO1-gata5 + MO1-smarcd3b standard conditions Fig. 1 with image from Lou et al., 2011
cardiac muscle cell decreased amount, abnormal WT + MO1-gata5 + MO1-smarcd3b standard conditions Fig. 1 with image from Lou et al., 2011
cardiac muscle cell differentiation disrupted, abnormal WT + MO1-gata5 + MO1-smarcd3b standard conditions Fig. 1 with image from Lou et al., 2011
cardiac muscle cell differentiation disrupted, abnormal WT + MO1-gata5 + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart tube bifurcated, abnormal WT + MO1-gata5 + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart morphogenesis disrupted, abnormal WT + MO1-gata5 + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
cardiac muscle cell decreased amount, abnormal WT + MO1-gata5 + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart morphogenesis disrupted, abnormal WT + MO1-gata5 + MO3-gata4 standard conditions Fig. 4 with imageFig. 5 with image from Peterkin et al., 2007
heart tube malformed, abnormal WT + MO1-gata5 + MO3-gata4 standard conditions Fig. 4 with imageFig. 5 with image from Peterkin et al., 2007
embryonic heart tube development disrupted, abnormal WT + MO1-gata5 + MO3-gata4 standard conditions Fig. 4 with imageFig. 5 with image from Peterkin et al., 2007
otic placode foxj1b expression amount, ameliorated mir210nju49/nju49 + MO1-gata5 + MO1-gata6 standard conditions Fig. S3 from Jia et al., 2018
myeloid cell differentiation occurrence, ameliorated mir210nju49/nju49 + MO1-gata5 + MO1-gata6 standard conditions Fig. 3 from Jia et al., 2018
yolk syncytial layer slc3a2a expression amount, ameliorated mir210nju49/nju49 + MO1-gata5 + MO1-gata6 standard conditions Fig. S3 from Jia et al., 2018
granulocyte mpx expression amount, ameliorated mir210nju49/nju49 + MO1-gata5 + MO1-gata6 standard conditions Fig. 3 from Jia et al., 2018
heart morphogenesis arrested, abnormal WT + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
cardiac muscle cell decreased amount, abnormal WT + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
cardiac muscle cell differentiation disrupted, abnormal WT + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart tube bifurcated, abnormal WT + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
lateral mesoderm EGFP expression decreased amount, abnormal hsc70Tg + MO1-gata5 + MO1-gata6 standard conditions Fig. 2 with image from Yuan et al., 2018
margin EGFP expression absent, abnormal hsc70Tg + MO1-gata5 + MO1-gata6 standard conditions Fig. 2 with image from Yuan et al., 2018
heart physical object quality, abnormal twu34Tg + MO1-gata5 + MO1-gata6 standard conditions Fig. 2 with image from Holtzinger et al., 2007
cardiac muscle cell decreased amount, abnormal twu34Tg + MO1-gata5 + MO1-gata6 standard conditions Fig. 2 with image from Holtzinger et al., 2007
heart morphogenesis disrupted, abnormal twu34Tg + MO1-gata5 + MO1-smarcd3b standard conditions Fig. 1 with image from Lou et al., 2011
heart bifurcated, abnormal twu34Tg + MO1-gata5 + MO1-smarcd3b standard conditions Fig. 1 with image from Lou et al., 2011
cardiac muscle cell differentiation disrupted, abnormal twu34Tg + MO1-gata5 + MO1-smarcd3b standard conditions Fig. 1 with image from Lou et al., 2011
cardiac muscle cell differentiation disrupted, abnormal twu34Tg + MO1-gata5 + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart morphogenesis disrupted, abnormal twu34Tg + MO1-gata5 + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart bifurcated, abnormal twu34Tg + MO1-gata5 + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart physical object quality, abnormal twu34Tg + MO1-gata5 + MO2-gata4 standard conditions Fig. 2 with image from Holtzinger et al., 2007
heart bifurcated, abnormal twu34Tg + MO1-gata5 + MO2-gata4 standard conditions Fig. 2 with image from Holtzinger et al., 2007
heart morphology, abnormal el133Tg + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. S1 with image from Lou et al., 2011
pharyngeal musculature morphology, abnormal el133Tg + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. S1 with image from Lou et al., 2011
whole organism EGFP expression absent, abnormal knu9Tg + MO1-gata5 + MO1-gata6 + MO5-gata4(AB) standard conditions Fig. 6 with image from Park et al., 2009
heart absent, abnormal knu9Tg + MO1-gata5 + MO1-gata6 + MO5-gata4(AB) standard conditions Fig. 6 with image from Park et al., 2009
endocardium aplastic, abnormal s843Tg + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. S1 with image from Lou et al., 2011
heart morphogenesis disrupted, abnormal twu34Tg + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
cardiac muscle cell differentiation disrupted, abnormal twu34Tg + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart bifurcated, abnormal twu34Tg + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
Citations