|
SPOUT1/CENP-32 patient variants show decreased methyltransferase activity. A Mapping of the SPOUT1/CENP-32 variants in the SPOUT1/CENP-32 71-376 SAH-bound structure. Variant residues are highlighted in purple. B Methyltransferase assay to determine the Km and Vmax of SPOUT1/CENP-32 WT and the variants in the presence of constant SAM (20 μM) and increasing amounts of a GAPDH mRNA hairpin as substrate (GCCCCCUCUGCUGAUGCCCCCAUGUUCGUCAUGGGUGUGAA; 0 – 100 μM; left panel). Km and Vmax values for all SPOUT1/CENP-32 proteins are depicted in the table (right panel). R square values are as follows: SPOUT1/CENP-32 WT – 0.79 (n = 10), SPOUT1/CENP-32 N86D – 0.83 (n = 6), SPOUT1/CENP32 G98S – 0.87 (n = 6), SPOUT1/CENP-32 G244S – 0.93 (n = 10), SPOUT1/CENP-32 T289M – 0.97 (n = 10), SPOUT1/CENP-32 G293S – 0.93 (n = 10), SPOUT1/CENP-32 T353M – 0.9 (n = 10), SPOUT1/CENP-32 T130R – 0.98 (n = 4). Data from three independent biological replicates, mean ± SD. Source data are provided as a Source Data file.
|