FIGURE

Fig. 7

ID

ZDB-FIG-250219-65

Publication

Dharmadhikari et al., 2025 - RNA methyltransferase SPOUT1/CENP-32 links mitotic spindle organization with the neurodevelopmental disorder SpADMiSS

Other Figures

All Figure Page

Back to All Figure Page

Fig. 7

SPOUT1/CENP-32 patient variants show decreased methyltransferase activity.

A Mapping of the SPOUT1/CENP-32 variants in the SPOUT1/CENP-32 71-376 SAH-bound structure. Variant residues are highlighted in purple. B Methyltransferase assay to determine the Km and Vmax of SPOUT1/CENP-32 WT and the variants in the presence of constant SAM (20 μM) and increasing amounts of a GAPDH mRNA hairpin as substrate (GCCCCCUCUGCUGAUGCCCCCAUGUUCGUCAUGGGUGUGAA; 0 – 100 μM; left panel). Km and Vmax values for all SPOUT1/CENP-32 proteins are depicted in the table (right panel). R square values are as follows: SPOUT1/CENP-32 WT – 0.79 (n = 10), SPOUT1/CENP-32 N86D – 0.83 (n = 6), SPOUT1/CENP32 G98S – 0.87 (n = 6), SPOUT1/CENP-32 G244S – 0.93 (n = 10), SPOUT1/CENP-32 T289M – 0.97 (n = 10), SPOUT1/CENP-32 G293S – 0.93 (n = 10), SPOUT1/CENP-32 T353M – 0.9 (n = 10), SPOUT1/CENP-32 T130R – 0.98 (n = 4). Data from three independent biological replicates, mean ± SD. Source data are provided as a Source Data file.

Expression Data

Expression Detail

Antibody Labeling

Phenotype Data

Phenotype Detail

Acknowledgments

This image is the copyrighted work of the attributed author or publisher, and ZFIN has permission only to display this image to its users. Additional permissions should be obtained from the applicable author or publisher of the image. Full text @ Nat. Commun.