|
SPOUT1/CENP-32 is an active Methyltransferase and its activity is crucial for its mitotic function. A Titration of methyltransferases (SPOUT1/CENP-32 and NSUN6) to assess the methyltransferase activity of SPOUT1/CENP-32 in vitro where Survivin protein was used as a negative control. Increasing amounts of either methyltransferase (NSUN6, a well-known RNA methyltransferase, or SPOUT1/CENP-32) or Survivin protein (0–20 μM) were incubated with 1 μg of total RNA extract (isolated from NSUN6 depleted or SPOUT1/CENP-32 depleted U2OS cells) and 20 μM SAM for 30 min at room temperature. RLU (Relative Luminescence unit). Data from three biological replicates, n = 9. Data represented as mean ± SEM. Source data are provided as a Source Data file. B Methyltransferase assay to determine the Km and Vmax of SPOUT1/CENP-32 WT and A356N in the presence of constant SAM (20 μM) and increasing amounts of a GAPDH mRNA hairpin as substrate (GCCCCCUCUGCUGAUGCCCCCAUGUUCGUCAUGGGUGUGAA; 0 – 100 μM). Km and Vmax values for SPOUT1/CENP-32 proteins are depicted in the table. RLU (Relative Luminescence unit). Data from three biological replicates, n = 6. Data represented as mean ± SEM. Source data are provided as a Source Data file. C Representative immunofluorescence images of SPOUT1/CENP-32 inducible U2OS cell lines for the analysis of centrosome detachment upon Control (siRNA C) or SPOUT1/CENP-32 (siRNA C32) depletion using siRNA oligos and rescue with either induction of SPOUT1/CENP32 WT-GFP or SPOUT1/CENP32 A356N-GFP expression. Conditions with doxycycline only. Conditions without doxycycline in Fig. S15F. D Quantification for the analysis of the centrosome detachment phenotype (% of cells with detached centrosomes; top panel) and chromosome segregation errors (% of micronuclei; bottom panel) in inducible U2OS cell lines expressing SPOUT1/CENP-32 WT-GFP or SPOUT1/CENP-32 A356N-GFP. Data are representative of a minimum of three biological replicates, mean ± SD, n = 3. Scale bar, 10 μm; Two-sided Fisher’s exact test with Bonferroni correction (****, P ≤ 0.0001). Exact p-values for the detached centrosome phenotype vs the WT condition are: A356N siRNA C +Dox=2.42E-06, A356N siRNA C32 +Dox=7.90E-20. Exact p-values for the micronuclei phenotype vs the WT condition are: A356N siRNA C32 +Dox=1.43E-11. Data points for each of the replicates are shown. Source data are provided as a Source Data file. E Cell viability evaluation of inducible U2OS cell lines expressing SPOUT1/CENP-32 WT-GFP or SPOUT1/CENP-32 A356N-GFP assessed by the MTT assay. Three independent biological replicates, mean ± SEM. WT siRNA C -Dox: n = 26; WT siRNA C32 -Dox; n = 26; WT siRNA C +Dox: n = 25; WT siRNA C32 +Dox: n = 27; A356N siRNA C -Dox: n = 11; A356N siRNA C32 -Dox: n = 18; A356N siRNA C +Dox: n = 13; A356N siRNA C32 +Dox: n = 18. Non-parametric ANOVA with Kruskal-Wallis followed by Dunn’s multiple comparisons test (***, P ≤ 0.001; ****, P ≤ 0.0001). Exact p-values vs the WT siRNA C -Dox condition are: WT siRNA C32 -Dox=1.44E-04, A356N siRNA C32 -Dox=1E-06, A356N siRNA C32 +Dox=1E-06. Source data are provided as a Source Data file.
|
