IMAGE

Fig. 6

ID
ZDB-IMAGE-250219-66
Publication
Dharmadhikari et al., 2025 - RNA methyltransferase SPOUT1/CENP-32 links mitotic spindle organization with the neurodevelopmental disorder SpADMiSS
All Figures
Figures for Dharmadhikari et al., 2025
Image
Figure Caption

Fig. 6 SPOUT1/CENP-32 is an active Methyltransferase and its activity is crucial for its mitotic function.

A Titration of methyltransferases (SPOUT1/CENP-32 and NSUN6) to assess the methyltransferase activity of SPOUT1/CENP-32 in vitro where Survivin protein was used as a negative control. Increasing amounts of either methyltransferase (NSUN6, a well-known RNA methyltransferase, or SPOUT1/CENP-32) or Survivin protein (0–20 μM) were incubated with 1 μg of total RNA extract (isolated from NSUN6 depleted or SPOUT1/CENP-32 depleted U2OS cells) and 20 μM SAM for 30 min at room temperature. RLU (Relative Luminescence unit). Data from three biological replicates, n = 9. Data represented as mean ± SEM. Source data are provided as a Source Data file. B Methyltransferase assay to determine the Km and Vmax of SPOUT1/CENP-32 WT and A356N in the presence of constant SAM (20 μM) and increasing amounts of a GAPDH mRNA hairpin as substrate (GCCCCCUCUGCUGAUGCCCCCAUGUUCGUCAUGGGUGUGAA; 0 – 100 μM). Km and Vmax values for SPOUT1/CENP-32 proteins are depicted in the table. RLU (Relative Luminescence unit). Data from three biological replicates, n = 6. Data represented as mean ± SEM. Source data are provided as a Source Data file. C Representative immunofluorescence images of SPOUT1/CENP-32 inducible U2OS cell lines for the analysis of centrosome detachment upon Control (siRNA C) or SPOUT1/CENP-32 (siRNA C32) depletion using siRNA oligos and rescue with either induction of SPOUT1/CENP32 WT-GFP or SPOUT1/CENP32 A356N-GFP expression. Conditions with doxycycline only. Conditions without doxycycline in Fig. S15F. D Quantification for the analysis of the centrosome detachment phenotype (% of cells with detached centrosomes; top panel) and chromosome segregation errors (% of micronuclei; bottom panel) in inducible U2OS cell lines expressing SPOUT1/CENP-32 WT-GFP or SPOUT1/CENP-32 A356N-GFP. Data are representative of a minimum of three biological replicates, mean ± SD, n = 3. Scale bar, 10 μm; Two-sided Fisher’s exact test with Bonferroni correction (****, P ≤ 0.0001). Exact p-values for the detached centrosome phenotype vs the WT condition are: A356N siRNA C +Dox=2.42E-06, A356N siRNA C32 +Dox=7.90E-20. Exact p-values for the micronuclei phenotype vs the WT condition are: A356N siRNA C32 +Dox=1.43E-11. Data points for each of the replicates are shown. Source data are provided as a Source Data file. E Cell viability evaluation of inducible U2OS cell lines expressing SPOUT1/CENP-32 WT-GFP or SPOUT1/CENP-32 A356N-GFP assessed by the MTT assay. Three independent biological replicates, mean ± SEM. WT siRNA C -Dox: n = 26; WT siRNA C32 -Dox; n = 26; WT siRNA C +Dox: n = 25; WT siRNA C32 +Dox: n = 27; A356N siRNA C -Dox: n = 11; A356N siRNA C32 -Dox: n = 18; A356N siRNA C +Dox: n = 13; A356N siRNA C32 +Dox: n = 18. Non-parametric ANOVA with Kruskal-Wallis followed by Dunn’s multiple comparisons test (***, P ≤ 0.001; ****, P ≤ 0.0001). Exact p-values vs the WT siRNA C -Dox condition are: WT siRNA C32 -Dox=1.44E-04, A356N siRNA C32 -Dox=1E-06, A356N siRNA C32 +Dox=1E-06. Source data are provided as a Source Data file.

Acknowledgments
This image is the copyrighted work of the attributed author or publisher, and ZFIN has permission only to display this image to its users. Additional permissions should be obtained from the applicable author or publisher of the image. Full text @ Nat. Commun.