CRISPR

CRISPR5-brca2

ID
ZDB-CRISPR-250725-3
Name
CRISPR5-brca2
Previous Names
None
Target
Sequence
5' - AATAAGCGTCGTGTCGTCAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "CGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf4267 brca2
Expression
Gene expression in Wild Types + CRISPR5-brca2
No data available
Phenotype
Phenotype resulting from CRISPR5-brca2
No data available
Phenotype of all Fish created by or utilizing CRISPR5-brca2
Phenotype Fish Conditions Figures
interrenal gland neuroblastoma increased amount, abnormal zdf16Tg/zdf16Tg + CRISPR5-brca2 + CRISPR6-brca2 + CRISPR7-brca2 standard conditions Fig. 1 with image from Hayes et al., 2025
interrenal gland neuroblastoma increased amount, abnormal brca2zf4267/zf4267; zdf16Tg/zdf16Tg standard conditions Fig. 1 with image from Hayes et al., 2025
interrenal gland neuroblastoma EGFP expression increased distribution, abnormal brca2zf4267/zf4267; zdf16Tg/zdf16Tg standard conditions Fig. 1 with image from Hayes et al., 2025
interrenal gland neuroblastoma ab7-h2afx labeling amount, ameliorated brca2zf4267/+; tp53fb105/fb105; zdf16Tg/zdf16Tg cancer xenotransplantation, chemical treatment by environment: ceralasertib, chemical treatment by environment: olaparib Fig. 6 with image from Hayes et al., 2025
interrenal gland neuroblastoma EGFP expression increased amount, abnormal brca2zf4267/+; tp53fb105/fb105; zdf16Tg/zdf16Tg cancer xenotransplantation, chemical treatment by environment: olaparib Fig. 6 with image from Hayes et al., 2025
interrenal gland cell cycle G2/M phase transition increased occurrence, abnormal brca2zf4267/+; tp53fb105/fb105; zdf16Tg/zdf16Tg standard conditions Fig. 4 with image from Hayes et al., 2025
interrenal gland neuroblastoma ab4-chek1 labeling decreased amount, abnormal brca2zf4267/+; tp53fb105/fb105; zdf16Tg/zdf16Tg cancer xenotransplantation, chemical treatment by environment: ceralasertib Fig. 6 with image from Hayes et al., 2025
interrenal gland neuroblastoma ab4-chek1 labeling decreased amount, abnormal brca2zf4267/+; tp53fb105/fb105; zdf16Tg/zdf16Tg cancer xenotransplantation, chemical treatment by environment: ceralasertib, chemical treatment by environment: olaparib Fig. 6 with image from Hayes et al., 2025
interrenal gland neuroblastoma ab7-h2afx labeling decreased amount, abnormal brca2zf4267/+; tp53fb105/fb105; zdf16Tg/zdf16Tg cancer xenotransplantation, chemical treatment by environment: olaparib Fig. 6 with image from Hayes et al., 2025
interrenal gland neuroblastoma rrm2 expression increased amount, abnormal brca2zf4267/+; tp53fb105/fb105; zdf16Tg/zdf16Tg standard conditions Fig. 4 with image from Hayes et al., 2025
interrenal gland neuroblastoma aurka expression increased amount, abnormal brca2zf4267/+; tp53fb105/fb105; zdf16Tg/zdf16Tg standard conditions Fig. 4 with image from Hayes et al., 2025
interrenal gland neuroblastoma mad2l1 expression increased amount, abnormal brca2zf4267/+; tp53fb105/fb105; zdf16Tg/zdf16Tg standard conditions Fig. 4 with image from Hayes et al., 2025
interrenal gland cell cycle G1/S phase transition increased occurrence, abnormal brca2zf4267/+; tp53fb105/fb105; zdf16Tg/zdf16Tg standard conditions Fig. 4 with image from Hayes et al., 2025
interrenal gland neuroblastoma ab7-h2afx labeling decreased amount, abnormal brca2zf4267/+; tp53fb105/fb105; zdf16Tg/zdf16Tg cancer xenotransplantation, chemical treatment by environment: ceralasertib Fig. 6 with image from Hayes et al., 2025
interrenal gland neuroblastoma dnmt1 expression increased amount, abnormal brca2zf4267/+; tp53fb105/fb105; zdf16Tg/zdf16Tg standard conditions Fig. 4 with image from Hayes et al., 2025
interrenal gland neuroblastoma EGFP expression amount, ameliorated brca2zf4267/+; tp53fb105/fb105; zdf16Tg/zdf16Tg cancer xenotransplantation, chemical treatment by environment: ceralasertib, chemical treatment by environment: olaparib Fig. 6 with image from Hayes et al., 2025
interrenal gland neuroblastoma EGFP expression increased amount, abnormal brca2zf4267/+; tp53fb105/fb105; zdf16Tg/zdf16Tg cancer xenotransplantation, chemical treatment by environment: ceralasertib Fig. 6 with image from Hayes et al., 2025
interrenal gland neuroblastoma EGFP expression increased amount, abnormal brca2zf4267/+; tp53fb105/fb105; zdf16Tg/zdf16Tg cancer xenotransplantation Fig. 6 with image from Hayes et al., 2025
interrenal gland neuroblastoma neoplastic, metastatic, exacerbated brca2zf4267/+; tp53fb105/fb105; zdf16Tg/zdf16Tg standard conditions Fig. 2 with image from Hayes et al., 2025
interrenal gland neuroblastoma lig1 expression increased amount, abnormal brca2zf4267/+; tp53fb105/fb105; zdf16Tg/zdf16Tg standard conditions Fig. 4 with image from Hayes et al., 2025
interrenal gland neuroblastoma increased size, ameliorated brca2zf4267/zf4267; tp53fb105/fb105; zdf16Tg/zdf16Tg cancer xenotransplantation, chemical treatment by environment: olaparib, chemical treatment by environment: temozolomide Fig. 3 with image from Hayes et al., 2025
interrenal gland neuroblastoma increased size, abnormal brca2zf4267/zf4267; tp53fb105/fb105; zdf16Tg/zdf16Tg cancer xenotransplantation Fig. 3 with image from Hayes et al., 2025
interrenal gland nucleus Ab1-pcna labeling decreased amount, abnormal brca2zf4267/zf4267; tp53fb105/fb105; zdf16Tg/zdf16Tg cancer xenotransplantation, chemical treatment by environment: olaparib, chemical treatment by environment: temozolomide Fig. 3 with image from Hayes et al., 2025
interrenal gland neuroblastoma neoplastic, metastatic, exacerbated brca2zf4267/zf4267; tp53fb105/fb105; zdf16Tg/zdf16Tg standard conditions Fig. 2 with image from Hayes et al., 2025
heart neuroblastoma EGFP expression increased amount, abnormal brca2zf4267/zf4267; tp53fb105/fb105; zdf16Tg/zdf16Tg standard conditions Fig. 2 with image from Hayes et al., 2025
liver neuroblastoma EGFP expression increased amount, abnormal brca2zf4267/zf4267; tp53fb105/fb105; zdf16Tg/zdf16Tg standard conditions Fig. 2 with image from Hayes et al., 2025
orbit neuroblastoma Ab60-th labeling increased amount, abnormal brca2zf4267/zf4267; tp53fb105/fb105; zdf16Tg/zdf16Tg standard conditions Fig. 2 with image from Hayes et al., 2025
olfactory pit neuroblastoma EGFP expression increased amount, abnormal brca2zf4267/zf4267; tp53fb105/fb105; zdf16Tg/zdf16Tg standard conditions Fig. 2 with image from Hayes et al., 2025
gill neuroblastoma Ab60-th labeling increased amount, abnormal brca2zf4267/zf4267; tp53fb105/fb105; zdf16Tg/zdf16Tg standard conditions Fig. 2 with image from Hayes et al., 2025
interrenal gland nucleus ab7-h2afx labeling increased amount, abnormal brca2zf4267/zf4267; tp53fb105/fb105; zdf16Tg/zdf16Tg standard conditions Fig. 1 with image from Hayes et al., 2025
liver neuroblastoma neoplastic, metastatic, abnormal brca2zf4267/zf4267; tp53fb105/fb105; zdf16Tg/zdf16Tg standard conditions Fig. 2 with image from Hayes et al., 2025
interrenal gland nucleus low brightness, exacerbated brca2zf4267/zf4267; tp53fb105/fb105; zdf16Tg/zdf16Tg standard conditions Fig. 1 with image from Hayes et al., 2025
gill neuroblastoma neoplastic, metastatic, abnormal brca2zf4267/zf4267; tp53fb105/fb105; zdf16Tg/zdf16Tg standard conditions Fig. 2 with image from Hayes et al., 2025
interrenal gland neuroblastoma ab11-casp3 labeling increased amount, abnormal brca2zf4267/zf4267; tp53fb105/fb105; zdf16Tg/zdf16Tg cancer xenotransplantation, chemical treatment by environment: olaparib, chemical treatment by environment: temozolomide Fig. 3 with image from Hayes et al., 2025
olfactory pit neuroblastoma Ab60-th labeling increased amount, abnormal brca2zf4267/zf4267; tp53fb105/fb105; zdf16Tg/zdf16Tg standard conditions Fig. 2 with image from Hayes et al., 2025
gill neuroblastoma EGFP expression increased amount, abnormal brca2zf4267/zf4267; tp53fb105/fb105; zdf16Tg/zdf16Tg standard conditions Fig. 2 with image from Hayes et al., 2025
olfactory pit neuroblastoma neoplastic, metastatic, abnormal brca2zf4267/zf4267; tp53fb105/fb105; zdf16Tg/zdf16Tg standard conditions Fig. 2 with image from Hayes et al., 2025
orbit neuroblastoma EGFP expression increased amount, abnormal brca2zf4267/zf4267; tp53fb105/fb105; zdf16Tg/zdf16Tg standard conditions Fig. 2 with image from Hayes et al., 2025
liver neuroblastoma Ab60-th labeling increased amount, abnormal brca2zf4267/zf4267; tp53fb105/fb105; zdf16Tg/zdf16Tg standard conditions Fig. 2 with image from Hayes et al., 2025
heart neuroblastoma Ab60-th labeling increased amount, abnormal brca2zf4267/zf4267; tp53fb105/fb105; zdf16Tg/zdf16Tg standard conditions Fig. 2 with image from Hayes et al., 2025
interrenal gland nucleus Ab1-pcna labeling increased amount, abnormal brca2zf4267/zf4267; tp53fb105/fb105; zdf16Tg/zdf16Tg standard conditions Fig. 1 with image from Hayes et al., 2025
orbit neuroblastoma neoplastic, metastatic, abnormal brca2zf4267/zf4267; tp53fb105/fb105; zdf16Tg/zdf16Tg standard conditions Fig. 2 with image from Hayes et al., 2025
heart neuroblastoma neoplastic, metastatic, abnormal brca2zf4267/zf4267; tp53fb105/fb105; zdf16Tg/zdf16Tg standard conditions Fig. 2 with image from Hayes et al., 2025
Citations