CRISPR

CRISPR1-reln

ID
ZDB-CRISPR-190107-1
Name
CRISPR1-reln
Previous Names
None
Target
Sequence
5' - GGAGCAGGACGAGTGGGCGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
nub23 reln
Expression
Gene expression in Wild Types + CRISPR1-reln
No data available
Phenotype
Phenotype resulting from CRISPR1-reln
No data available
Phenotype of all Fish created by or utilizing CRISPR1-reln
Phenotype Fish Conditions Figures
stratum marginale reln expression absent, abnormal relnnub23/nub23(AB) standard conditions Fig. 8 with image from Nimura et al., 2019
Purkinje cell neuron projection disoriented, abnormal relnnub23/nub23(AB) standard conditions Fig. 7 with image from Nimura et al., 2019
cerebellar granule cell reln expression absent, abnormal relnnub23/nub23(AB) standard conditions Fig. 8 with image from Nimura et al., 2019
granular layer corpus cerebelli has extra parts of type Purkinje cell, abnormal relnnub23/nub23(AB) standard conditions Fig. 2 with imageFig. 3 with imageFig. 7 with image from Nimura et al., 2019
cerebellar Purkinje cell layer morphogenesis decreased occurrence, abnormal relnnub23/nub23(AB) standard conditions Fig. 2 with imageFig. 7 with image from Nimura et al., 2019
cerebellar crest reln expression absent, abnormal relnnub23/nub23(AB) standard conditions Fig. 8 with image from Nimura et al., 2019
torus longitudinalis granule cell reln expression absent, abnormal relnnub23/nub23(AB) standard conditions Fig. 8 with image from Nimura et al., 2019
molecular layer corpus cerebelli reln expression absent, abnormal relnnub23/nub23(AB) standard conditions Fig. 8 with image from Nimura et al., 2019
stratum opticum reln expression absent, abnormal relnnub23/nub23(AB) standard conditions Fig. 8 with image from Nimura et al., 2019
optic tectum neuron mislocalised radially, abnormal relnnub23/nub23(AB) standard conditions Fig. 6 with image from Nimura et al., 2019
Purkinje cell inserted into granular layer corpus cerebelli, abnormal relnnub23/nub23(AB) standard conditions Fig. 2 with imageFig. 3 with image from Nimura et al., 2019
Purkinje cell layer corpus cerebelli has fewer parts of type Purkinje cell, abnormal relnnub23/nub23(AB) standard conditions Fig. 2 with image from Nimura et al., 2019
granular layer corpus cerebelli has extra parts of type Purkinje cell, abnormal nkuasgfp1aTg ; relnnub23/nub23 ; nkhspGFFDMC28CEt(AB) standard conditions Fig. 3 with image from Nimura et al., 2019
Purkinje cell inserted into granular layer corpus cerebelli, abnormal nkuasgfp1aTg ; relnnub23/nub23 ; nkhspGFFDMC28CEt(AB) standard conditions Fig. 3 with image from Nimura et al., 2019
Bergmann glial cell inserted into granular layer corpus cerebelli, abnormal relnnub23/nub23 ; nkSAGFFLF251AEt ; nkuasgfp1aTg(AB) standard conditions Fig. 5 with image from Nimura et al., 2019
granular layer corpus cerebelli has extra parts of type Bergmann glial cell, abnormal relnnub23/nub23 ; nkSAGFFLF251AEt ; nkuasgfp1aTg(AB) standard conditions Fig. 5 with image from Nimura et al., 2019
eurydendroid cell inserted into granular layer corpus cerebelli, abnormal relnnub23/nub23; nkhspGFFDMC156AEt; nkuasgfp1aTg standard conditions Fig. 4 with image from Nimura et al., 2019
granular layer corpus cerebelli has extra parts of type eurydendroid cell, abnormal relnnub23/nub23; nkhspGFFDMC156AEt; nkuasgfp1aTg standard conditions Fig. 4 with image from Nimura et al., 2019
Purkinje cell layer corpus cerebelli has fewer parts of type eurydendroid cell, abnormal relnnub23/nub23; nkhspGFFDMC156AEt; nkuasgfp1aTg standard conditions Fig. 4 with image from Nimura et al., 2019
Citations