ZFIN ID: ZDB-TSCRIPT-130528-451
Transcript Name: srsf2a-008
Previous Name: sfrs2-008

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058776 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058776|OTTDARG00000020615|ZDB-GENE-040426-2706 srsf2a|OTTDARP00000045903 sfrs2-008 LG_ CR352342.9 Danio rerio protein_coding KNOWN, 855 bp
GACATCTTTAAAAGTCGACAATCTGACATACCGCACGTCT
CCTGAAACGCTGCGGCGGGTTTTCGAGAAATACGGCCGAG
TCGGAGACGTCTACATCCCAAGAGACCGGTACACAAAAGA
GAGCCGCGGATTCGCCTTTGTCCGTTTCCATGATAAGCGG
GACGCGGAGGACGCGATGGATGCCATGGACGGCGCATTGC
TGGACGGGCGCGAGCTGCGCGTGCAGATGGCGCGATATGG
GCGCCCGCCAGACGCGCACTACAGCCGCCGCGGAGCCCCG
CCGAGGAGATACGGGGGATATGGACGGAGAAGTCGAAGCC
GTAGTCCTCGGCGCAGGAAGCACAGCAGGTCCCGCTACAG
CCGATCCAGATCCCGGTCTTACTCTCGTTCCCGGTCTCGG
TCCCGATCCCGCTCCAAAACCCGCACCCCTCGCAGAAGCA
AGTCAAAATCACCTTCCAGGTCCCGCTCAAGGTCCAAGTC
CAAATCTCACTCCAGGAGCCGCACCCCCAGATCGAACAAA
GGATCCAAATCCAGGTCCAGATCAAGAAGCAGACCCAAGT
CTCCAGAGGCTACTGATGACGCTGCTGTTGAATCGTGAAA
TATGATGACTGGTTGAATCTTCAAGGATCGCAGTGAACAG
ATGTCCGTCTGAGGATACCCAAATTATCCATATATCAGAC
CGAAAGGTTATTGTAATTTGGTCTACATCTTTTTAAATGA
TTTTGTTTCTCCTCTTTTGCCCACATTTTTGTATCAAACA
CATTTCATGTGATATTAAATGATCTTTATGCCTAATTGGG
GATATTAGGTGAAATCATTTCTCTTCATTTTGGTAGTTTG
CTTATTTGTTTTCCC

srsf2a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA srsf2a-001 (1) 1776
ncRNA srsf2a-002 (1) 1024
mRNA srsf2a-003 (1) 1151
aberrant processed transcript srsf2a-004 (1) 567
srsf2a-005 (1) 603
srsf2a-006 (1) 582
mRNA srsf2a-007 (1) 707
srsf2a-008 855
aberrant processed transcript srsf2a-009 (1) 908
ncRNA srsf2a-010 (1) 636
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
srsf2a-008 Contained in:
OTHER srsf2a-008 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000058776 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT655174 (1) 878bp
    GenBank:CT655175 (1) 705bp
    CITATIONS (1)