ZFIN ID: ZDB-TSCRIPT-090929-8566
Transcript Name: srsf2a-004
Previous Names: sfrs2-004, srsf2-004

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025860 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025860|OTTDARG00000020615|ZDB-GENE-040426-2706 srsf2a|OTTDARP00000045904 sfrs2-004 LG_ CR352342.9 Danio rerio protein_coding KNOWN, 567 bp
AAGCAGGTCCCGCTACAGCCGATCCAGATCCCGGTCTTAC
TCTCGTTCCCGGTCTCGGTCCCGATCCCGCTCCAAAACCC
GCACCCCTCGCAGAAGCAAGTCAAAATCACCTTCCAGGTC
CCGCTCAAGGTCCAAGTCCAAATCTCACTCCAGGAGCCGC
ACCCCCAGATCGAACAAAGGATCCAAATCCAGGTCCAGAT
CAAGAAGCAGACCCAAGTCTCCAGAGGCTACTGATGACGC
TGCTGTTGAATCGTGAAATCTGCTGATTCCTGTTTGCAAA
AGAGGAGTTTGGGGCAGTTTGAGAGCAGTTAGTGTGTGAT
CCGACCATTGGCTGCCTGCTGCTGATTGGCGGTTGCTATG
GAGCAGGTCGGTCTCATTTGAGTGTTGAGGTGGTGTTGAG
ATGATGACTGGTTGAATCTTCAAGGATCGCAGTGAACAGA
TGTCCGTCTGAGGATACCCAAATTATCCATATATCAGACC
GAAAGGTTATTGTAATTTGGTCTACATCTTTTTAAATGAT
TTTGTTTCTCCTCTTTTGCCCACATTTTTGTATCAAACAC
ATTTCAT

srsf2a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA srsf2a-001 (1) 1776
ncRNA srsf2a-002 (1) 1024
mRNA srsf2a-003 (1) 1151
aberrant processed transcript srsf2a-004 567
srsf2a-005 (1) 603
srsf2a-006 (1) 582
mRNA srsf2a-007 (1) 707
srsf2a-008 (1) 855
aberrant processed transcript srsf2a-009 (1) 908
ncRNA srsf2a-010 (1) 636
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
srsf2a-004 Contained in:
OTHER srsf2a-004 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025860 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AL908131 (1) 561bp
    GenBank:AL908130 (1) 515bp
    CITATIONS (1)