header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8566
Transcript Name: srsf2a-205
Previous Names: sfrs2-004, srsf2-004, srsf2a-004

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025860 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025860|OTTDARG00000020615|ZDB-GENE-040426-2706 srsf2a|OTTDARP00000045904 sfrs2-004 LG_ CR352342.9 Danio rerio protein_coding KNOWN, 567 bp
AAGCAGGTCCCGCTACAGCCGATCCAGATCCCGGTCTTAC
TCTCGTTCCCGGTCTCGGTCCCGATCCCGCTCCAAAACCC
GCACCCCTCGCAGAAGCAAGTCAAAATCACCTTCCAGGTC
CCGCTCAAGGTCCAAGTCCAAATCTCACTCCAGGAGCCGC
ACCCCCAGATCGAACAAAGGATCCAAATCCAGGTCCAGAT
CAAGAAGCAGACCCAAGTCTCCAGAGGCTACTGATGACGC
TGCTGTTGAATCGTGAAATCTGCTGATTCCTGTTTGCAAA
AGAGGAGTTTGGGGCAGTTTGAGAGCAGTTAGTGTGTGAT
CCGACCATTGGCTGCCTGCTGCTGATTGGCGGTTGCTATG
GAGCAGGTCGGTCTCATTTGAGTGTTGAGGTGGTGTTGAG
ATGATGACTGGTTGAATCTTCAAGGATCGCAGTGAACAGA
TGTCCGTCTGAGGATACCCAAATTATCCATATATCAGACC
GAAAGGTTATTGTAATTTGGTCTACATCTTTTTAAATGAT
TTTGTTTCTCCTCTTTTGCCCACATTTTTGTATCAAACAC
ATTTCAT

srsf2a TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript srsf2a-202 (1)    Ensembl 582
srsf2a-205 567
srsf2a-206 (1)    Ensembl 603
srsf2a-208 (1)    Ensembl 908
mRNA srsf2a-201 (1)    Ensembl 1776
srsf2a-204 (1)    Ensembl 1151
srsf2a-207 (1)    Ensembl 855
srsf2a-209 (1)    Ensembl 707
ncRNA srsf2a-002 (1)    Ensembl 1024
srsf2a-010 (1)    Ensembl 636
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
srsf2a-205 Contained in:

Genome Resources: Vega_Trans:OTTDART00000025860 (1),  Ensembl_Trans:ENSDART00000140550 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AL908131 (1) 561 bp
GenBank:AL908130 (1) 515 bp
CITATIONS (2)