ZFIN ID: ZDB-TSCRIPT-090929-8568
Transcript Name: srsf2a-202
Previous Names: sfrs2-006, srsf2-006, srsf2a-006

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025862 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025862|OTTDARG00000020615|ZDB-GENE-040426-2706 srsf2a|OTTDARP00000045891 sfrs2-006 LG_ CR352342.9 Danio rerio protein_coding KNOWN, 582 bp
CCAGGTCCCGCTCAAGGTCCAAGTCCAAATCTCACTCCAG
GAGCCGCACCCCCAGATCGAACAAAGGATCCAAATCCAGG
TCCAGATCAAGAAGCAGACCCAAGTCTCCAGAGGCTACTG
ATGACGCTGCTGTTGAATCGTGAAATCTGCTGATTCCTGT
TTGCAAAAGAGGAGTTTGGGGCAGTTTGAGAGCAGTTAGT
GTGTGATCCGACCATTGGCTGCCTGCTGCTGATTGGCGGT
TGCTATGGAGCAGATGATGACTGGTTGAATCTTCAAGGAT
CGCAGTGAACAGATGTCCGTCTGAGGATACCCAAATTATC
CATATATCAGACCGAAAGGTTATTGTAATTTGGTCTACAT
CTTTTTAAATGATTTTGTTTCTCCTCTTTTGCCCACATTT
TTGTATCAAACACATTTCATGTGATATTAAATGATCTTTA
TGCCTAATTGGGGATATTAGGTGAAATCATTTCTCTTCAT
TTTGGTAGTTTGCTTATTTGTTTTCCCCTTCCCTACTTCA
TGTTATTGAACCTCACAGACTTTAACGTAAGTTCATTTTA
ATTAGTTTTTTTGTTCTTAATA

srsf2a TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript srsf2a-202 582
srsf2a-205 (1)    Ensembl 567
srsf2a-206 (1)    Ensembl 603
srsf2a-208 (1)    Ensembl 908
mRNA srsf2a-201 (1)    Ensembl 1776
srsf2a-204 (1)    Ensembl 1151
srsf2a-207 (1)    Ensembl 855
srsf2a-209 (1)    Ensembl 707
ncRNA srsf2a-002 (1)    Ensembl 1024
srsf2a-010 (1)    Ensembl 636
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
srsf2a-202 Contained in:
[BAC] CH211-134H7 (1)

Genome Resources: Vega_Trans:OTTDART00000025862 (1),  Ensembl_Trans:ENSDART00000132753 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AL910729 (1) 447 bp
GenBank:BI983715 (1) 444 bp
GenBank:BI983722 (1) 314 bp
CITATIONS (2)