header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8564
Transcript Name: srsf2a-002
Previous Names: sfrs2-002, srsf2-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025858 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025858|OTTDARG00000020615|ZDB-GENE-040426-2706 srsf2a|no_translation sfrs2-002 LG_ CR352342.9 Danio rerio protein_coding KNOWN, 1024 bp
CGTGTTTGTCTCCACTCTCTCGAATGGTTCGCTAATTTCT
TTGTAAATCTCGCTGGTAACCGTTTTATTTCTTCCATAAC
AGACTGCTGTAGAGTTAGTGATTCAAGATGAGCTACGGCA
GACCACCGCCCGACGTCGAGGGCATGACATCTTTAAAAGT
CGACAATCTGACATACCGCACGTCTCCTGAAACGCTGCGG
CGGGTTTTCGAGAAATACGGCCGAGTCGGAGACGTCTACA
TCCCAAGAGACCGGTACACAAAAGAGAGCCGCGGATTCGC
CTTTGTCCGTTTCCATGATAAGCGGGACGCGGAGGACGCG
ATGGATGCCATGGACGGCGCATTGCTGGACGGGCGCGAGC
TGCGCGTGCAGATGGCGCGATATGGGCGCCCGCCAGACGC
GCACTACAGCCGCCGCGGAGCCCCGCCGAGGAGATACGGG
GGATATGGACGGAGAAGTCGAAGCCGTAGTCCTCGGCGCA
GGAAGCACAGCAGGTCCAGATCCAGAAGCAGGAGCCGGTC
TCGTTCCCGAAGCAGGTCCCGCTACAGCCGATCCAGATCC
CGGTCTTACTCTCGTTCCCGGTCTCGGTCCCGATCCCGCT
CCAAAACCCGCACCCCTCGCAGAAGCAAGTCAAAATCACC
TTCCAGGTCCCGCTCAAGGTCCAAGTCCAAATCTCACTCC
AGGAGCCGCACCCCCAGATCGAACAAAGGATCCAAATCCA
GGTCCAGATCAAGAAGCAGACCCAAGTCTCCAGAGGCTAC
TGATGACGCTGCTGTTGAATCGTGAAATGTAAGCAAACCT
AGTGCTTTAAATGAAAGTTTAAATCCTATTTATTGCAAGT
GGGTGGGTGGGTGATATACACAGTTATCCAAGAAAAAAAG
TGCTGTTAAATATTGTATTACCATGATTTGAGCAGATCTG
CTTATTGACCCTCTTGTAACTCATGCCAGAAATGAAATGA
AGGCATGCATGCATGCAATTTAGTAACTTTATAATAGTTG
CTTTTACTGTTTGCCCCCTCTGCT

srsf2a TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript srsf2a-202 (1)    Ensembl 582
srsf2a-205 (1)    Ensembl 567
srsf2a-206 (1)    Ensembl 603
srsf2a-208 (1)    Ensembl 908
mRNA srsf2a-201 (1)    Ensembl 1776
srsf2a-204 (1)    Ensembl 1151
srsf2a-207 (1)    Ensembl 855
srsf2a-209 (1)    Ensembl 707
ncRNA srsf2a-002 1024
srsf2a-010 (1)    Ensembl 636
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
srsf2a-002 Contained in:

Genome Resources: Vega_Trans:OTTDART00000025858 (1),  Ensembl_Trans:ENSDART00000136278 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CA470207 (1) 893 bp
GenBank:CA476382 (1) 892 bp
GenBank:CD757991 (1) 885 bp
GenBank:EB959163 (1) 617 bp
CITATIONS (2)