Transcript

srsf2a-206

ID
ZDB-TSCRIPT-090929-8567
Name
srsf2a-206
Previous Names
  • sfrs2-005
  • srsf2-005
  • srsf2a-005
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025861 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025861|OTTDARG00000020615|ZDB-GENE-040426-2706 srsf2a|OTTDARP00000045902 sfrs2-005 LG_ CR352342.9 Danio rerio protein_coding KNOWN, 603 bp
GTCTCCAGAGGCTACTGATGACGCTGCTGTTGAATCGTGA
AATCTGCTGATTCCTGTTTGCAAAAGAGGAGTTTGGGGCA
GTTTGAGAGCAGTTAGTGTGTGATCCGACCATTGGCTGCC
TGCTGCTGATTGGCGGTTGCTATGGAGCAGATGATGACTG
GTTGAATCTTCAAGGATCGCAGTGAACAGATGTCCGTCTG
AGGATACCCAAATTATCCATATATCAGACCGAAAGGCGCA
GTTGCGTAGCAGTTGAGTTTTGCTGGTTAGCTGTTAAGGT
GGCGTGTTGCGGTGCAGAGTGCTTGGCTGTTTCCAGTATT
CTCCTGATTGCTCCTGTGTAACGCCCCGATTTGTTTAAAT
TTGGCTGCTGCGTTTTTATTTGCAGAAACATCTTGTGCAA
GTCTTTTTATGAATATTCATAATGCAGATGTCTGAGCTTA
ACTCATATCCACAATAGTTCCATCATTCAACATGCTCAAT
TTGTAGTAATTTCCATGTGAGTGGTAATAAAGGTTTCCTT
TGTGTATACCTAATTCTTTACTGGTCTGTCAGTGTCTCTT
ATGATGTTTGATGTAAACGCGCAAATTAAAAGCCTCCATA
ACT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations