Transcript

srsf2a-208

ID
ZDB-TSCRIPT-130528-197
Name
srsf2a-208
Previous Names
  • sfrs2-009
  • srsf2a-009
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058775 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058775|OTTDARG00000020615|ZDB-GENE-040426-2706 srsf2a|OTTDARP00000045901 sfrs2-009 LG_ CR352342.9 Danio rerio protein_coding KNOWN, 908 bp
CATTGCTGGACGGGCGCGAGCTGCGCGTGCAGATGGCGCG
ATATGGGCGCCCGCCAGACGCGCACTACAGCCGCCGCGGA
GCCCCGCCGAGGAGATACGGGGGATATGGACGGAGAAGTC
GAAGCCGTAGTCCTCGGCGCAGGAAGCACAGCAGGTCCAG
ATCCAGAAGCAGGAGCCGGTCTCGTTCCCGAAGCAGGTCC
CGCTACAGCCGATCCAGATCCCGGTCTTACTCTCGTTCCC
GGTCTCGGTCCCGATCCCGCTCCAAAACCCGCACCCCTCG
CAGAAGCAAGTCAAAATCACCTTCCAGGTCCCGCTCAAGG
TCCAAGTCCAAATCTCACTCCAGGAGCCGCACCCCCAGAT
CGAACAAAGGATCCAAATCCAGGTCCAGATCAAGAAGCAG
ACCCAAGTCTCCAGAGGCTACTGATGACGCTGCTGTTGAA
TCGTGAAATATGATGACTGGTTGAATCTTCAAGGATCGCA
GTGAACAGATGTCCGTCTGAGGATACCCAAATTATCCATA
TATCAGACCGAAAGGCGCAGTTGCGTAGCAGTTGAGTTTT
GCTGGTTAGCTGTTAAGGTGGCGTGTTGCGGTGCAGAGTG
CTTGGCTGTTTCCAGTATTCTCCTGATTGCTCCTGTGTAA
CGCCCCGATTTGTTTAAATTTGGCTGCTGCGTTTTTATTT
GCAGAAACATCTTGTGCAAGTCTTTTTATGAATATTCATA
ATGCAGATGTCTGAGCTTAACTCATATCCACAATAGTTCC
ATCATTCAACATGCTCAATTTGTAGTAATTTCCATGTGAG
TGGTAATAAAGGTTTCCTTTGTGTATACCTAATTCTTTAC
TGGTCTGTCAGTGTCTCTTATGATGTTTGATGTAAACGCG
CAAATTAAAAGCCTCCATAACTGGAAAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations