Transcript

lmo7a-012

ID
ZDB-TSCRIPT-090929-15389
Name
lmo7a-012
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000034653 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034653|OTTDARG00000026179|ZDB-GENE-030219-74 lmo7a|no_translation DKEY-57A22.10-012 LG_ CR536604.6 Danio rerio protein_coding NOVEL, 895 bp
CTAATTTGTCTTCTATTAATGTTGTTCAATCATGTCCGTG
TGAACATCTGCTTGTCTGTGCTGATTCTGCTGTTGGCCAC
ACAGTAAGGTGGACTCCTTTTGCTATACCAATGTTTACCC
TGAATTATCCTACTCACACAGGTAATCAGACTGTTTGCAC
TAACATTTGCACTTAACAAAGCAATGCTTTCAGGTTTGGG
GCTCCTGCAGTAAAGAAACTTACATTAAGCTCTTTTCATC
TGCAGGTCCATTTCCAAATCTACCCCAGAACTTGATGAAG
TTGCAAAAACAGATATTAAAGGTGTCTACGGCAGACACAG
GGGTTTGGCAGGATGGCTGCTGGAGGAGGAACTGAGGCGA
AAGAAAAACCCTCAAATGCAGAGAAAGCAGGCAGCAAGTG
AGCTAGAGCTCGAGAGGAGAAGCATTCTTAATGCCATGAA
ATACCGAAACCCAGAAAGAGCAAGCGGTGGTCTGAGTGAG
GTCAACAGGGACTATCAGAAAGAGCCTCTAACTCAGTCTG
AGCTGGAGAGGCAGCAGATCCTTCAGGAAATGAGGAAGAA
AACTTCCCTGAACACAGACAACAGCTGGATTCGCCAGAGC
ACTTCTAGTGTCCCTGCCAAAGAGCCAATCGATCTACCCA
TAAGAAGAGGTGAGTCTCTTGACAACCTTGATGAGCCTCG
TTCCTCCTGGAGATCATCATGGAGCACGTCAAACAGCACC
TCGTCCATACCAGACTATAGCCGGCCACATTCAGCCCTCT
CTGGCTCCACATTGCAGCCGGCTGGACGTCCAGGCTCTGC
CACTATGCAGGCATCTCAATCCATGAGCTCTCTCAGGCAG
TCCACTTCCACACCTGCAAACCCACCAGAGCCTCGAGCTC
CACAGAGAAACAGGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations