Transcript

lmo7a-202

ID
ZDB-TSCRIPT-090929-15386
Name
lmo7a-202
Previous Names
  • lmo7a-009
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000034650 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034650|OTTDARG00000026179|ZDB-GENE-030219-74 lmo7a|OTTDARP00000027911 DKEY-57A22.10-009 LG_ CR536604.6 Danio rerio protein_coding NOVEL, 812 bp
CAGAGATCAGATAGTGCAAGACTCACCTCTGTAGTCATGC
CCAGGCCATTCGGCACACAGTCCAACAGAATTGCCTCCCT
TCCCAGAGCGTTCACGATGGATGACTCTGTTAAACGCACA
AATGGAGAGAGCAACAGCCTTAAGAAAACGGCAGTTCAAA
ACCGCTATGCTCAGTACATGACAGATGAAGACAAGTCCCA
GCAAACCCCTGATCACAGCAGCGAAGAAGAGGAAGTGGAG
AGAACCCAATCTCCTGTCCCTCCGGTCAACAGGGTATCCC
CCTTGCCCAAATCTACATCCCCACTCAACCCTCCCAATGA
GGTGGGCTACAATGAGATGAGGATCAGCCTGAACCAGAAG
CCCAACAGCAGTCGAGACTTCGGCTTCCAGCATGACTGGG
ACTCCACAGGTGTCCGTGTCAAATCTGTTGCTCCGGGCAG
CCCAGCAGAGTTTGGTCAAGTGCAGGCTGGAGATGAGATC
CTAACAGTGAATGGACACAGGGTGGCAGACATGAGCTACA
GTGAGTGGAAGAACAGTATGGAGGAGGCCCTGCAGCAGGG
CAGTCTACTTATGGACATCCGCAGACAGGGAAAGAACAGT
CCCTCCGAGCCATATCACACCACCAGCCTGGACTTCACAT
CCCAACAATCCAAGGACGCCGTTGTGAAATCTGTCAACGT
CAGCTCACAGCCAGCTTATAATCATGGCTCAAATGGGATT
AATGGTGCTTTCCGTGAGGATTCAGAGAGTGTGAATAATA
AAGAATCCATTTCTTTGAAAAACTTAAAAAGGAGATCAGA
GTTTTTTGAACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations