ZFIN ID: ZDB-TSCRIPT-090929-15383
Transcript Name: lmo7a-210
Previous Name: lmo7a-006

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034647 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034647|OTTDARG00000026179|ZDB-GENE-030219-74 lmo7a|OTTDARP00000027910 DKEY-57A22.10-006 LG_ CR536604.6 Danio rerio protein_coding NOVEL, 663 bp
CCAGGACCTATAGCACATCCTCAGACGCCACACTCAAAGG
CAGCAGCGAGGGTTGTGGCAGTGACCCTGAAGCAGATCTG
AGCTTCACCATGGCAGACAATAAGGAGTACCGCCGTTCAC
AGGTCATAGCACCTAAGACTACTACTCAGTTCAATCAGTT
TCTCCCATCACGGGACAAGCAGTCCGGCTATGTTCCAGCA
CCATTACGCAAGAAACGTGCAGAGCGAAATGAAGACAGCA
GAAGAAGCTGGGCAAGCCCTATGTTCACAGAAGATGACGG
CACTTTCACTAGACTTTTCCAGAAAAACTCTGATAGTGAA
GGGAGCAAATCAGTGAGCGACATTACAGAAAGTGAGATGA
GCAACTCTACGATGGAGTTGCGTCTTGAGGAGCTGCAGAA
GATGCGTAACCGTTTGAAGGAGAGTGAGGATAAGTGGCAA
GATGATCTTTCAAGGTGGAAGAGTAAGCGCAGGAGTGTCA
ATTCTGACATTGTCAAGAAGAAAGAGGAGCGAGAGCAGAT
CGAGCAGATCACTTCAGTTGGCACCAGGAAATCAAAAACC
TTCAAGGAGATGCAGGATGAGAGAGAGAGCAGAGGGCAAA
GCAACTTAAGGGACAGCTTTAACTCCATCGTTGATGATGT
CTTTGAAGATCCTGTTCCCCGAA

lmo7a TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript lmo7a-203 (1)    Ensembl 625
mRNA lmo7a-201 (1)    Ensembl 6323
lmo7a-202 (1)    Ensembl 812
lmo7a-204 (1)    Ensembl 1052
lmo7a-210 663
lmo7a-212 (1)    Ensembl 754
ncRNA lmo7a-003 (1)    Ensembl 962
lmo7a-004 (1)    Ensembl 914
lmo7a-005 (1)    Ensembl 733
lmo7a-007 (1)    Ensembl 824
lmo7a-008 (1)    Ensembl 740
lmo7a-012 (1)    Ensembl 895
lmo7a-013 (1)    Ensembl 853
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lmo7a-210 Contained in:
[BAC] DKEY-57A22 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000034647 (1),  Ensembl_Trans:ENSDART00000144843 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EB981837 (1) 663 nt
GenBank:EB980689 (1) 641 nt
GenBank:EB897480 (1) 503 nt
GenBank:EB893504 (1) 474 nt
CITATIONS (2)