header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-15388
Transcript Name: lmo7a-204
Previous Name: lmo7a-011

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034652 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034652|OTTDARG00000026179|ZDB-GENE-030219-74 lmo7a|OTTDARP00000027913 DKEY-57A22.10-011 LG_ CR536604.6 Danio rerio protein_coding NOVEL, 1052 bp
GGAACAACAGCGTCTGGAGGAACTGAGGAGGAAGAGGGAA
GAGGAACAGCGCCTCCTTCAGGAGAAAGAGCGGAACAGAA
GAGAGGAGGAGAAGAAGAGATTTCAGGAGCAAGATAAGGT
GGACTCCTTTTGCTATACCAATGTTTACCCTGAATTATCC
TACTCACACAGGTCCATTTCCAAATCTACCCCAGAACTTG
ATGAAGTTGCAAAAACAGATATTAAAGGTGTCTACGGCAG
ACACAGGGGTTTGGCAGGATGGCTGCTGGAGGAGGAACTG
AGGCGAAAGAAAAACCCTCAAATGCAGAGAAAGCAGGCAG
CAAGTGAGCTAGAGCTCGAGAGGAGAAGCATTCTTAATGC
CATGAAATACCGAAACCCAGAAAGAGCAAGCGGTGGTCTG
AGTGAGGTCAACAGGGACTATCAGAAAGAGCCTCTAACTC
AGTCTGAGCTGGAGAGGCAGCAGATCCTTCAGGAAATGAG
GAAGAAAACTTCCCTGAACACAGACAACAGCTGGATTCGC
CAGAGCACTTCTAGTGTCCCTGCCAAAGAGCCAATCGATC
TACCCATAAGAAGAGGTGAGTCTCTTGACAACCTTGATGA
GCCTCGTTCCTCCTGGAGATCATCATGGAGCACGTCAAAC
AGCACCTCGTCCATACCAGACTATAGCCGGCCACATTCAG
CCCTCTCTGGCTCCACATTGCAGCCGGCTGGACGTCCAGG
CTCTGCCACTATGCAGGCATCTCAATCCATGAGCTCTCTC
AGGCAGTCCACTTCCACACCTGCAAACCCACCAGAGCCTC
GAGCTCCACAGAGAAACAGGTCAGTGAGTGGCAGGAAAAT
CTGTTCATTCTGTGATACACCGCTGGGCAAAGGAGCAGCC
ATGATCATCGAGTCCCTGGGGCTTTGTTATCATTTGACTT
GTTTCAAGTGTTCTGACTGCAGGTCTGATCTGGGAGGCTC
ACAAGCAGGAGCAGAAGTCAGAATACGAAACCAGCAGCTC
TATTGTAACGTCTGCTATATGCGGCTCAAAAGTAGGCCAG
ACATCTCTGCAA

lmo7a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA lmo7a-003 (1) 962
lmo7a-004 (1) 914
lmo7a-005 (1) 733
lmo7a-007 (1) 824
lmo7a-008 (1) 740
lmo7a-012 (1) 895
lmo7a-013 (1) 853
mRNA lmo7a-201 (1) 6323
lmo7a-202 (1) 812
aberrant processed transcript lmo7a-203 (1) 625
mRNA lmo7a-204 1052
lmo7a-210 (1) 663
lmo7a-212 (1) 754
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lmo7a-204 Contained in:
[BAC] DKEY-57A22 (1) (order this)

OTHER lmo7a-204 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000034652 (1)
  • Ensembl_Trans:ENSDART00000134768 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH485298 (1) 935 bp
    GenBank:EE712048 (1) 870 bp
    GenBank:DT077510 (1) 808 bp
    CITATIONS (2)