Transcript

lmo7a-204

ID
ZDB-TSCRIPT-090929-15388
Name
lmo7a-204
Previous Names
  • lmo7a-011
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000034652 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034652|OTTDARG00000026179|ZDB-GENE-030219-74 lmo7a|OTTDARP00000027913 DKEY-57A22.10-011 LG_ CR536604.6 Danio rerio protein_coding NOVEL, 1052 bp
GGAACAACAGCGTCTGGAGGAACTGAGGAGGAAGAGGGAA
GAGGAACAGCGCCTCCTTCAGGAGAAAGAGCGGAACAGAA
GAGAGGAGGAGAAGAAGAGATTTCAGGAGCAAGATAAGGT
GGACTCCTTTTGCTATACCAATGTTTACCCTGAATTATCC
TACTCACACAGGTCCATTTCCAAATCTACCCCAGAACTTG
ATGAAGTTGCAAAAACAGATATTAAAGGTGTCTACGGCAG
ACACAGGGGTTTGGCAGGATGGCTGCTGGAGGAGGAACTG
AGGCGAAAGAAAAACCCTCAAATGCAGAGAAAGCAGGCAG
CAAGTGAGCTAGAGCTCGAGAGGAGAAGCATTCTTAATGC
CATGAAATACCGAAACCCAGAAAGAGCAAGCGGTGGTCTG
AGTGAGGTCAACAGGGACTATCAGAAAGAGCCTCTAACTC
AGTCTGAGCTGGAGAGGCAGCAGATCCTTCAGGAAATGAG
GAAGAAAACTTCCCTGAACACAGACAACAGCTGGATTCGC
CAGAGCACTTCTAGTGTCCCTGCCAAAGAGCCAATCGATC
TACCCATAAGAAGAGGTGAGTCTCTTGACAACCTTGATGA
GCCTCGTTCCTCCTGGAGATCATCATGGAGCACGTCAAAC
AGCACCTCGTCCATACCAGACTATAGCCGGCCACATTCAG
CCCTCTCTGGCTCCACATTGCAGCCGGCTGGACGTCCAGG
CTCTGCCACTATGCAGGCATCTCAATCCATGAGCTCTCTC
AGGCAGTCCACTTCCACACCTGCAAACCCACCAGAGCCTC
GAGCTCCACAGAGAAACAGGTCAGTGAGTGGCAGGAAAAT
CTGTTCATTCTGTGATACACCGCTGGGCAAAGGAGCAGCC
ATGATCATCGAGTCCCTGGGGCTTTGTTATCATTTGACTT
GTTTCAAGTGTTCTGACTGCAGGTCTGATCTGGGAGGCTC
ACAAGCAGGAGCAGAAGTCAGAATACGAAACCAGCAGCTC
TATTGTAACGTCTGCTATATGCGGCTCAAAAGTAGGCCAG
ACATCTCTGCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations