header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-15382
Transcript Name: lmo7a-005
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034646 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034646|OTTDARG00000026179|ZDB-GENE-030219-74 lmo7a|no_translation DKEY-57A22.10-005 LG_ CR536604.6 Danio rerio protein_coding NOVEL, 733 bp
CGCTCTTATCCAGATAGCTGGTACTCAGAGAGAGAAGAGC
TCTTCCCGCTGCGGGCCGGACACAGGAGAGAAGACTCTCT
AGACAGCCTCAATTCGCTGGGCTCCAGGACCTATAGCACA
TCCTCAGACGCCACACTCAAAGGCAGCAGCGAGGGTTGTG
GCAGTGACCCTGAAGCAGATCTGAGCTTCACCATGGCAGA
CAATAAGGAGTACCGCCGTTCACAGGTCATAGCACCTAAG
ACTACTACTCAGTTCAATCAGTTTCTCCCATCACGGGACA
AGCAGTCCGGCTATGTTCCAGCACCATTACGCAAGAAACG
TGCAGAGCGAAATGAAGACAGCAGAAGAAGCTGGGCAAGC
CCTATGTTCACAGAAGATGACGGCACTTTCACTAGCCACA
AGAAGTCAGGTTCGTCCTCGGAAGAATCAGACGGTGACGT
CAATCCCTGGCCTTCTGTTCCCACTTTCTCCCGCACTCAG
TCTGAACCCCCTCGCTCTCACTCCCATTCACCCGAAGGCC
TTGCCCTGCCAAGCCTCACTTCTACACACAGTTCTCAAAC
ACAACCCCTCACTGTTGCTCAGCAGATTGTCGGGCTGCCT
AAATTTGAGCCACCTGATTTTTGGCCCAGTCCAGATCCCT
CCTCTGGCCCCAGACTCATAAAATGTGAAAAGCATCCACT
CCTTGGACGAGAACATCCTAATGACCCGTACAACGTTTCT
GCCGACATCCTGC

lmo7a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA lmo7a-003 (1) 962
lmo7a-004 (1) 914
lmo7a-005 733
lmo7a-007 (1) 824
lmo7a-008 (1) 740
lmo7a-012 (1) 895
lmo7a-013 (1) 853
mRNA lmo7a-201 (1) 6323
lmo7a-202 (1) 812
aberrant processed transcript lmo7a-203 (1) 625
mRNA lmo7a-204 (1) 1052
lmo7a-210 (1) 663
lmo7a-212 (1) 754
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lmo7a-005 Contained in:
[BAC] DKEY-57A22 (1) (order this)

OTHER lmo7a-005 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000034646 (1)
  • Ensembl_Trans:ENSDART00000136534 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK027063 (1) 731 bp
    CITATIONS (2)