ZFIN ID: ZDB-MRPHLNO-110810-1
Morpholino Name: MO1-npc1
Target: npc1 (1)
Sequence:
5' - TGTGGTTTCTCCCCAGCAGAAGCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-npc1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-npc1
Expressed Gene Anatomy Figures
foxd3 whole organism anterior region Fig. 9 from Schwend et al., 2011
pcdh8 segmental plate Fig. 9 from Schwend et al., 2011
ta forerunner cell group, mesoderm, notochord (all 4) expand Fig. 4Fig. 9 from Schwend et al., 2011
PHENOTYPE 
Phenotype resulting from MO1-npc1
Phenotype Figures
actin cytoskeleton organization disrupted, abnormal Fig. 7 from Schwend et al., 2011
blood island thrombocyte absent, abnormal Fig. 5 from Louwette et al., 2013
blood island thrombocyte decreased amount, abnormal Fig. 5 from Louwette et al., 2013
brain morphology, abnormal Fig. 4 from Louwette et al., 2013
cell death increased occurrence, abnormal Fig. 9 from Schwend et al., 2011
epiboly involved in gastrulation with mouth forming second delayed, abnormal Fig. 3Fig. 4Fig. 6 from Schwend et al., 2011
eye morphology, abnormal Fig. 4 from Louwette et al., 2013
head malformed, abnormal Fig. 4 from Louwette et al., 2013
intracellular cholesterol transport disrupted, abnormal Fig. 7 with image from Chu et al., 2015
lateral mesoderm increased width, abnormal Fig. 9 from Schwend et al., 2011
notochord increased width, abnormal Fig. 9 from Schwend et al., 2011
nucleate erythrocyte decreased amount, abnormal Fig. 5 from Louwette et al., 2013
programmed cell death increased occurrence, abnormal Fig. 4 from Louwette et al., 2013
regulation of cholesterol storage disrupted, abnormal Fig. 4 from Louwette et al., 2013
segmental plate increased width, abnormal Fig. 9 from Schwend et al., 2011
whole organism dead, abnormal Fig. 5 from Louwette et al., 2013
whole organism decreased length, abnormal Fig. 9 from Schwend et al., 2011
whole organism viability, abnormal text only from Schwend et al., 2011
whole organism cholesterol increased amount, abnormal Fig. 7 with image from Chu et al., 2015

Phenotype of all Fish created by or utilizing MO1-npc1
Phenotype Fish Conditions Figures
segmental plate increased width, abnormal WT + MO1-npc1 standard conditions Fig. 9 from Schwend et al., 2011
cell death increased occurrence, abnormal WT + MO1-npc1 standard conditions Fig. 9 from Schwend et al., 2011
lateral mesoderm increased width, abnormal WT + MO1-npc1 standard conditions Fig. 9 from Schwend et al., 2011
eye morphology, abnormal WT + MO1-npc1 standard conditions Fig. 4 from Louwette et al., 2013
intracellular cholesterol transport disrupted, abnormal WT + MO1-npc1 standard conditions Fig. 7 with image from Chu et al., 2015
brain morphology, abnormal WT + MO1-npc1 standard conditions Fig. 4 from Louwette et al., 2013
notochord increased width, abnormal WT + MO1-npc1 standard conditions Fig. 9 from Schwend et al., 2011
whole organism cholesterol increased amount, abnormal WT + MO1-npc1 standard conditions Fig. 7 with image from Chu et al., 2015
head malformed, abnormal WT + MO1-npc1 standard conditions Fig. 4 from Louwette et al., 2013
regulation of cholesterol storage disrupted, abnormal WT + MO1-npc1 standard conditions Fig. 4 from Louwette et al., 2013
whole organism viability, abnormal WT + MO1-npc1 standard conditions text only from Schwend et al., 2011
epiboly involved in gastrulation with mouth forming second delayed, abnormal WT + MO1-npc1 standard conditions Fig. 3Fig. 4Fig. 6 from Schwend et al., 2011
programmed cell death increased occurrence, abnormal WT + MO1-npc1 standard conditions Fig. 4 from Louwette et al., 2013
whole organism decreased length, abnormal WT + MO1-npc1 standard conditions Fig. 9 from Schwend et al., 2011
actin cytoskeleton organization disrupted, abnormal WT + MO1-npc1 standard conditions Fig. 7 from Schwend et al., 2011
whole organism dead, abnormal la2Tg + MO1-npc1 standard conditions Fig. 5 from Louwette et al., 2013
blood island thrombocyte decreased amount, abnormal la2Tg + MO1-npc1 standard conditions Fig. 5 from Louwette et al., 2013
blood island thrombocyte absent, abnormal la2Tg + MO1-npc1 standard conditions Fig. 5 from Louwette et al., 2013
nucleate erythrocyte decreased amount, abnormal sd2Tg + MO1-npc1 standard conditions Fig. 5 from Louwette et al., 2013
OTHER MO1-npc1 MORPHOLINO PAGESNo links to external sites
CITATIONS (3)