ZFIN ID: ZDB-MRPHLNO-100524-9
Morpholino Name: MO1-ehmt2
Target: ehmt2 (1)
Previous Name: g9a MO1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GACACACACTGACCTGCAGATGATC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ehmt2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ehmt2
Expressed Gene Anatomy Figures
ascl1a Fig. 8 with image from Rai et al., 2010
ascl1b Fig. 6 with imageFig. 8 with image from Rai et al., 2010
crx Fig. 6 with image from Rai et al., 2010
fabp2 Fig. 6 with image from Rai et al., 2010
lef1 Fig. S3 with image from Olsen et al., 2016
Fig. 8 with image from Rai et al., 2010
neurod1 Fig. 6 with image from Rai et al., 2010
rbp3 Fig. 6 with image from Rai et al., 2010
PHENOTYPE
Phenotype resulting from MO1-ehmt2
Phenotype Figures
amacrine cell ab1-gaba labeling absent, abnormal Fig. S4 with image from Olsen et al., 2016
brain decreased size, abnormal Fig. 6 with image from Rai et al., 2010
eye decreased size, abnormal Fig. 2 with imageFig. S2 with image from Olsen et al., 2016
histone H3-K9 methylation decreased occurrence, abnormal Fig. 8 with image from Rai et al., 2010
midbrain lef1 expression decreased amount, abnormal Fig. S3 with image from Olsen et al., 2016
midbrain morphology, abnormal Fig. 2 with imageFig. S2 with image from Olsen et al., 2016
midbrain apoptotic process increased occurrence, abnormal Fig. 7 with image from Olsen et al., 2016
pericardium edematous, abnormal Fig. 6 with image from Rai et al., 2010
retina ab5-casp3 labeling increased amount, abnormal Fig. 5 with image from Olsen et al., 2016
retina apoptotic process increased occurrence, abnormal Fig. 5 with image from Olsen et al., 2016
retina apoptotic process process quality, ameliorated Fig. 5 with image from Olsen et al., 2016
retina cell population proliferation increased occurrence, abnormal Fig. S4 with image from Olsen et al., 2016
retina nucleus Ab34-h3 labeling decreased amount, abnormal Fig. S3 with image from Olsen et al., 2016
retinal bipolar neuron ab2-prkcb labeling absent, abnormal Fig. S4 with image from Olsen et al., 2016
retinal cone cell zpr-1 labeling absent, abnormal Fig. S4 with image from Olsen et al., 2016

Phenotype of all Fish created by or utilizing MO1-ehmt2
Phenotype Fish Conditions Figures
retinal bipolar neuron ab2-prkcb labeling absent, abnormal AB + MO1-ehmt2 standard conditions Fig. S4 with image from Olsen et al., 2016
midbrain lef1 expression decreased amount, abnormal AB + MO1-ehmt2 standard conditions Fig. S3 with image from Olsen et al., 2016
midbrain apoptotic process increased occurrence, abnormal AB + MO1-ehmt2 standard conditions Fig. 7 with image from Olsen et al., 2016
retina apoptotic process increased occurrence, abnormal AB + MO1-ehmt2 standard conditions Fig. 5 with image from Olsen et al., 2016
midbrain morphology, abnormal AB + MO1-ehmt2 standard conditions Fig. 2 with imageFig. S2 with image from Olsen et al., 2016
retina cell population proliferation increased occurrence, abnormal AB + MO1-ehmt2 standard conditions Fig. S4 with image from Olsen et al., 2016
retina nucleus Ab34-h3 labeling decreased amount, abnormal AB + MO1-ehmt2 standard conditions Fig. S3 with image from Olsen et al., 2016
retinal cone cell zpr-1 labeling absent, abnormal AB + MO1-ehmt2 standard conditions Fig. S4 with image from Olsen et al., 2016
retina ab5-casp3 labeling increased amount, abnormal AB + MO1-ehmt2 standard conditions Fig. 5 with image from Olsen et al., 2016
amacrine cell ab1-gaba labeling absent, abnormal AB + MO1-ehmt2 standard conditions Fig. S4 with image from Olsen et al., 2016
eye decreased size, abnormal AB + MO1-ehmt2 standard conditions Fig. 2 with imageFig. S2 with image from Olsen et al., 2016
retina apoptotic process process quality, ameliorated AB + MO1-ehmt2 + MO4-tp53 standard conditions Fig. 5 with image from Olsen et al., 2016
pericardium edematous, abnormal WT + MO1-ehmt2 standard conditions Fig. 6 with image from Rai et al., 2010
histone H3-K9 methylation decreased occurrence, abnormal WT + MO1-ehmt2 standard conditions Fig. 8 with image from Rai et al., 2010
brain decreased size, abnormal WT + MO1-ehmt2 standard conditions Fig. 6 with image from Rai et al., 2010
retina central region vsx2 expression mislocalised, abnormal AB + MO1-ehmt2 + MO1-znf644a standard conditions Fig. 6 with image from Olsen et al., 2016
retina central region ccnd1 expression spatial pattern, abnormal AB + MO1-ehmt2 + MO1-znf644a standard conditions Fig. S6 with image from Olsen et al., 2016
midbrain ccnd1 expression mislocalised, abnormal AB + MO1-ehmt2 + MO1-znf644a standard conditions Fig. S6 with image from Olsen et al., 2016
midbrain ccnd1 expression spatial pattern, abnormal AB + MO1-ehmt2 + MO1-znf644a standard conditions Fig. S6 with image from Olsen et al., 2016
retina central region ccnd1 expression mislocalised, abnormal AB + MO1-ehmt2 + MO1-znf644a standard conditions Fig. S6 with image from Olsen et al., 2016
retina cell population proliferation increased occurrence, abnormal AB + MO1-ehmt2 + MO1-znf644a standard conditions Fig. 6 with imageFig. S6 with image from Olsen et al., 2016
retina apoptotic process increased occurrence, abnormal AB + MO1-ehmt2 + MO1-znf644b standard conditions Fig. 6 with image from Olsen et al., 2016
retina central region vsx2 expression mislocalised, abnormal AB + MO1-ehmt2 + MO1-znf644b standard conditions Fig. 6 with image from Olsen et al., 2016
midbrain ccnd1 expression mislocalised, abnormal AB + MO1-ehmt2 + MO1-znf644b standard conditions Fig. S6 with image from Olsen et al., 2016
midbrain ccnd1 expression spatial pattern, abnormal AB + MO1-ehmt2 + MO1-znf644b standard conditions Fig. S6 with image from Olsen et al., 2016
retina central region ccnd1 expression spatial pattern, abnormal AB + MO1-ehmt2 + MO1-znf644b standard conditions Fig. S6 with image from Olsen et al., 2016
retina central region ccnd1 expression mislocalised, abnormal AB + MO1-ehmt2 + MO1-znf644b standard conditions Fig. S6 with image from Olsen et al., 2016
retina cell population proliferation increased occurrence, abnormal AB + MO1-ehmt2 + MO1-znf644b standard conditions Fig. 6 with imageFig. S6 with image from Olsen et al., 2016
retina ab5-casp3 labeling increased amount, abnormal AB + MO1-ehmt2 + MO1-znf644b standard conditions Fig. 6 with image from Olsen et al., 2016
OTHER MO1-ehmt2 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)