header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100506-1
Morpholino Name: MO1-tardbp
Target: tardbp (1)
Previous Name: AMO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GTACATCTCGGCCATCTTTCCTCAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This is the corrected sequence for the tardbp MO published in Hum. Mol. Genet. 19(4): 671-683.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-tardbp No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-tardbp
Expressed Gene Anatomy Figures
pls3 Fig. 1 from Hao et al., 2012
smn1 Fig. 1 from Hao et al., 2012
PHENOTYPE
Phenotype resulting from MO1-tardbp
Phenotype of all Fish created by or utilizing MO1-tardbp
Phenotype Fish Conditions Figures
locomotory behavior having decreased processual parts skeletal muscle contraction, abnormal WT + MO1-tardbp standard conditions Fig. 4Fig. 5 from Kabashi et al., 2010
motor neuron axon decreased length, abnormal WT + MO1-tardbp standard conditions Fig. 6 with image from Kabashi et al., 2011
locomotory behavior disrupted, abnormal WT + MO1-tardbp standard conditions Fig. 4Fig. 5 from Kabashi et al., 2010
peripheral neuron decreased length, abnormal WT + MO1-tardbp standard conditions Fig. 4Fig. 5 from Kabashi et al., 2010
sensory perception of touch disrupted, abnormal WT + MO1-tardbp standard conditions Fig. 6 with image from Kabashi et al., 2011
thigmotaxis disrupted, abnormal WT + MO1-tardbp standard conditions Fig. 5 from Kabashi et al., 2010
peripheral neuron branchiness, abnormal WT + MO1-tardbp standard conditions Fig. 4Fig. 5 from Kabashi et al., 2010
CaP motoneuron axon decreased length, abnormal ml2Tg + MO1-tardbp standard conditions Fig. 4 with imageFig. 5 from Chitramuthu et al., 2017
axon extension process quality, abnormal ml2Tg + MO1-tardbp standard conditions Fig. 4 with image from Chitramuthu et al., 2017
thigmotaxis decreased process quality, abnormal ml2Tg + MO1-tardbp standard conditions Fig. 5 from Chitramuthu et al., 2017
sensory perception of touch disrupted, abnormal WT + MO1-fus + MO1-tardbp standard conditions Fig. 6 with image from Kabashi et al., 2011
motor neuron axon decreased length, abnormal WT + MO1-fus + MO1-tardbp standard conditions Fig. 6 with image from Kabashi et al., 2011
sensory perception of touch disrupted, abnormal WT + MO1-sod1 + MO1-tardbp standard conditions text only from Kabashi et al., 2011
motor neuron axon decreased length, abnormal WT + MO1-sod1 + MO1-tardbp standard conditions text only from Kabashi et al., 2011
OTHER MO1-tardbp MORPHOLINO PAGESNo links to external sites
CITATIONS (4)