Community Action Needed: Please respond to the NIH RFI
Morpholino

MO3-disc1

ID
ZDB-MRPHLNO-090825-1
Name
MO3-disc1
Previous Names
  • MOE3 (1)
Target
Sequence
5' - GGACTCGATCTAATGAGAGAAATCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
designed for the intron 2/exon 3 splice-acceptor site to alter splicing of the disc1 pre-mRNA, deleting exon 3, which introduces a premature stop site and a severely truncated protein.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-disc1
Phenotype
Phenotype resulting from MO3-disc1
Phenotype of all Fish created by or utilizing MO3-disc1
Citations