ZFIN ID: ZDB-MRPHLNO-080703-4
Morpholino Name: MO1-gli2b
Target: gli2b (1)
Previous Name: gli2bATG (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CGGGAGCTGGAACACCGGCCTCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This is a translation blocking morpholino that targets gli2b.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-gli2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-gli2b
Expressed Gene Anatomy Figures
alcama Fig. 5 with image from Ke et al., 2008
dnajc2 Fig. 1 with image from Ke et al., 2008
egr2b Fig. S2 with image from Ke et al., 2008
gfap Fig. 1 with image from Ke et al., 2008
hoxa2b Fig. S2 with image from Ke et al., 2008
hoxb3a Fig. S2 with image from Ke et al., 2008
mafba Fig. S2 with image from Ke et al., 2008
neurod4 Fig. 2 with image from Ke et al., 2008
neurog1 Fig. 3 with image from Ke et al., 2008
nkx2.2a Fig. 6 with image from Ke et al., 2008
notch1a Fig. 3 with image from Ke et al., 2008
notch1b Fig. 3 with image from Ke et al., 2008
ntn1a Fig. 6 with image from Ke et al., 2008
olig2 Fig. 4 with image from Ke et al., 2008
PHENOTYPE
Phenotype resulting from MO1-gli2b
Phenotype Figures
abducens motor nucleus aplastic, abnormal Fig. 5 with image from Ke et al., 2008
axonogenesis disrupted, abnormal Fig. S2 with image from Ke et al., 2008
brain decreased size, abnormal text only from Ke et al., 2008
facial nerve motor nucleus mislocalised laterally, abnormal Fig. 5 with image from Ke et al., 2008
floor plate formation disrupted, abnormal Fig. 6 with image from Ke et al., 2008
floor plate rhombomere region increased width, abnormal Fig. 6 with image from Ke et al., 2008
fourth ventricle increased size, abnormal text only from Ke et al., 2008
hindbrain astrocyte decreased amount, abnormal Fig. 1 with image from Ke et al., 2008
oligodendrocyte differentiation disrupted, abnormal Fig. 4 with image from Ke et al., 2008
Rohon-Beard neuron decreased amount, abnormal Fig. 5 with image from Ke et al., 2008
secondary motor neuron decreased amount, abnormal Fig. 5 with image from Ke et al., 2008
trigeminal motor nucleus mislocalised laterally, abnormal Fig. 5 with image from Ke et al., 2008

Phenotype of all Fish created by or utilizing MO1-gli2b
Phenotype Fish Conditions Figures
floor plate formation disrupted, abnormal WT + MO1-gli2b standard conditions Fig. 6 with image from Ke et al., 2008
hindbrain astrocyte decreased amount, abnormal WT + MO1-gli2b standard conditions Fig. 1 with image from Ke et al., 2008
oligodendrocyte differentiation disrupted, abnormal WT + MO1-gli2b standard conditions Fig. 4 with image from Ke et al., 2008
facial nerve motor nucleus mislocalised laterally, abnormal WT + MO1-gli2b standard conditions Fig. 5 with image from Ke et al., 2008
Rohon-Beard neuron decreased amount, abnormal WT + MO1-gli2b standard conditions Fig. 5 with image from Ke et al., 2008
axonogenesis disrupted, abnormal WT + MO1-gli2b standard conditions Fig. S2 with image from Ke et al., 2008
secondary motor neuron decreased amount, abnormal WT + MO1-gli2b standard conditions Fig. 5 with image from Ke et al., 2008
fourth ventricle increased size, abnormal WT + MO1-gli2b standard conditions text only from Ke et al., 2008
abducens motor nucleus aplastic, abnormal WT + MO1-gli2b standard conditions Fig. 5 with image from Ke et al., 2008
brain decreased size, abnormal WT + MO1-gli2b standard conditions text only from Ke et al., 2008
floor plate rhombomere region increased width, abnormal WT + MO1-gli2b standard conditions Fig. 6 with image from Ke et al., 2008
trigeminal motor nucleus mislocalised laterally, abnormal WT + MO1-gli2b standard conditions Fig. 5 with image from Ke et al., 2008
floor plate formation disrupted, abnormal gli2aty17a/ty17a + MO1-gli2b standard conditions Fig. 6 with image from Ke et al., 2008
facial nerve motor nucleus decreased amount, abnormal gli2aty17a/ty17a + MO1-gli2b standard conditions Fig. 5 with image from Ke et al., 2008
vagal lobe aplastic, abnormal gli2aty17a/ty17a + MO1-gli2b standard conditions Fig. 5 with image from Ke et al., 2008
Rohon-Beard neuron decreased amount, abnormal gli2aty17a/ty17a + MO1-gli2b standard conditions Fig. 5 with image from Ke et al., 2008
trigeminal motor nucleus aplastic, abnormal gli2aty17a/ty17a + MO1-gli2b standard conditions Fig. 5 with image from Ke et al., 2008
OTHER MO1-gli2b MORPHOLINO PAGESNo links to external sites
CITATIONS (4)