header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-080329-2
Morpholino Name: MO4-sox2
Target: sox2 (1)
Previous Name: sox2-MO2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GAGAGGCTGCTGAAGTTACCTTAGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-sox2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-sox2
Expressed Gene Anatomy Figures
gli1 Fig. 5 from Chassaing et al., 2016
ptch1 Fig. 5 from Chassaing et al., 2016
sox2 Fig. 1 from Kamachi et al., 2008
PHENOTYPE
Phenotype resulting from MO4-sox2
Phenotype of all Fish created by or utilizing MO4-sox2
Phenotype Fish Conditions Figures
caudal fin upturned, abnormal WT + MO3-sox2 + MO4-sox2 standard conditions Fig. 1 with image from Okuda et al., 2010
somite shape, abnormal WT + MO4-sox2 standard conditions Fig. S3 from Chassaing et al., 2016
whole organism ptch1 expression increased amount, abnormal WT + MO4-sox2 standard conditions Fig. 5 from Chassaing et al., 2016
whole organism gli1 expression increased amount, abnormal WT + MO4-sox2 standard conditions Fig. 5 from Chassaing et al., 2016
eye decreased size, abnormal WT + MO4-sox2 standard conditions Fig. 3 from Chassaing et al., 2016
central nervous system abnormal, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO4-sox2 standard conditions Fig. 1 with image from Okuda et al., 2010
central nervous system abnormal, abnormal WT + MO1-sox19a + MO2-sox19a + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 1 with image from Okuda et al., 2010
central nervous system abnormal, abnormal WT + MO1-sox19b + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 1 with image from Okuda et al., 2010
epiboly delayed, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 2Fig. S8 from Leichsenring et al., 2013
Fig. 1 with image from Okuda et al., 2010
whole organism wholly dorsalized, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 4 with image from Okuda et al., 2010
notochord broad, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 1 with imageFig. 2 with image from Okuda et al., 2010
neurogenesis disrupted, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 1 with imageFig. 2 with image from Okuda et al., 2010
convergent extension disrupted, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 1 with imageFig. 2 with image from Okuda et al., 2010
mesoderm increased width, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 3 with image from Okuda et al., 2010
axis shortened, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 1 with imageFig. 2 with image from Okuda et al., 2010
somite malformed, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 2Fig. S8 from Leichsenring et al., 2013
tail bud aplastic, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 2Fig. S8 from Leichsenring et al., 2013
central nervous system abnormal, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 1 with image from Okuda et al., 2010
whole organism truncated, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 2Fig. S8 from Leichsenring et al., 2013
neural plate increased width, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 1 with imageFig. 2 with image from Okuda et al., 2010
neural plate development disrupted, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 3 with image from Okuda et al., 2010
hindbrain development disrupted, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 5 with image from Okuda et al., 2010
central nervous system development disrupted, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 1 with imageFig. 2 with image from Okuda et al., 2010
brain development disrupted, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 5 with image from Okuda et al., 2010
head aplastic, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 2Fig. S8 from Leichsenring et al., 2013
anterior neural plate formation disrupted, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 5 with image from Okuda et al., 2010
prechordal plate increased distance notochord, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 1 with imageFig. 2 with image from Okuda et al., 2010
whole organism embryo development arrested, abnormal pou5f3m793/m793 + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 2Fig. S8 from Leichsenring et al., 2013
Genome Resources:
CITATIONS (6)