header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070829-2
Morpholino Name: MO2-ednraa
Target: ednraa (1)
Previous Names: ednra2 MO (1), MO2-ednra

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ATCAGACTTTTCTTTACCTGCTTAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: targets 6th, transmembrane domain; splice blocker
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-ednraa No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-ednraa
Expressed Gene Anatomy Figures
dlx2a Fig. 4 with image from Nair et al., 2007
en2a Fig. 4 with image from Nair et al., 2007
gsc Fig. 4 with image from Nair et al., 2007
hand2 Fig. 4 with image from Nair et al., 2007
PHENOTYPE
Phenotype resulting from MO2-ednraa
No data available

Phenotype of all Fish created by or utilizing MO2-ednraa
OTHER MO2-ednraa MORPHOLINO PAGESNo links to external sites
CITATIONS (2)