Morpholino

MO1-apln

ID
ZDB-MRPHLNO-070522-5
Name
MO1-apln
Previous Names
  • MOapln-spl (1)
Target
Sequence
5' - AACAGCCGTCACGCTCCCGACTTAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-apln
Expressed Gene Anatomy Figures
lft1 Fig. 8 with image from Zhu et al., 2019
lft2 Fig. 6 with image from Zhu et al., 2019
myh7 Fig. 4 from Zeng et al., 2007
shha Fig. 8 with image from Zhu et al., 2019
spaw Fig. 6 with image from Zhu et al., 2019
Phenotype
Phenotype resulting from MO1-apln
Phenotype Fish Figures
apoptotic process decreased occurrence, abnormal WT + MO1-apln + MO4-tp53 Fig. S4 from Zeng et al., 2007
apoptotic process increased occurrence, abnormal WT + MO1-apln Fig. S4 from Zeng et al., 2007
determination of heart left/right asymmetry process quality, abnormal twu34Tg + MO1-apln Fig. 5\ with image from Zhu et al., 2019
determination of left/right asymmetry in lateral mesoderm decreased occurrence, abnormal AB + MO1-apln Fig. 6 with image from Zhu et al., 2019
determination of liver left/right asymmetry decreased occurrence, abnormal AB + MO1-apln Fig. 5\ with image from Zhu et al., 2019
determination of liver left/right asymmetry process quality, abnormal as3Tg + MO1-apln Fig. 5\ with image from Zhu et al., 2019
heart development disrupted, abnormal WT + MO1-apln Fig. S4 from Zeng et al., 2007
heart looping decreased occurrence, abnormal twu34Tg + MO1-apln Fig. 5\ with image from Zhu et al., 2019
heart primordium lft2 expression absent, abnormal AB + MO1-apln Fig. 6 with image from Zhu et al., 2019
heart primordium right side lft2 expression mislocalised, abnormal AB + MO1-apln Fig. 6 with image from Zhu et al., 2019
Kupffer's vesicle decreased size, abnormal AB + MO1-apln Fig. 3,  Fig. 6 with image from Zhu et al., 2019
lateral plate mesoderm spaw expression absent, abnormal AB + MO1-apln Fig. 6 with image from Zhu et al., 2019
lateral plate mesoderm right side spaw expression mislocalised, abnormal AB + MO1-apln Fig. 6 with image from Zhu et al., 2019
lymph vessel development process quality, abnormal s896Tg; y7Tg + MO1-apln Fig. 2,  Fig. 4,  Fig. 5 from Kim et al., 2014
lymph vessel endothelium endothelial cell decreased amount, abnormal s896Tg; y7Tg + MO1-apln Fig. 2,  Fig. 4,  Fig. 5 from Kim et al., 2014
mesodermal cell migration disrupted, abnormal WT + MO1-apln Fig. 6,  Fig. 7 from Zeng et al., 2007
parachordal vessel absent, abnormal y7Tg + MO1-apln Fig. 2 from Kim et al., 2014
parachordal vessel agenesis, abnormal y1Tg + MO1-apln Fig. S6 with image from Kwon et al., 2016
parachordal vessel malformed, abnormal y7Tg + MO1-apln Fig. 2 from Kim et al., 2014
pericardium edematous, abnormal aplnmu267/+ + MO1-apln Fig. S6 with image from Kwon et al., 2016
thoracic duct has fewer parts of type endothelial cell, abnormal s896Tg; y7Tg + MO1-apln Fig. 2 from Kim et al., 2014
trunk medial region lft1 expression decreased amount, abnormal AB + MO1-apln Fig. 8 with image from Zhu et al., 2019
whole organism apoptotic, abnormal WT + MO1-apln Fig. S4 from Zeng et al., 2007
whole organism medial region shha expression increased amount, abnormal AB + MO1-apln Fig. 8 with image from Zhu et al., 2019
Phenotype of all Fish created by or utilizing MO1-apln
Phenotype Fish Conditions Figures
pericardium edematous, abnormal aplnmu267/mu267 + MO1-apln standard conditions Fig. S6 with image from Kwon et al., 2016
lateral plate mesoderm spaw expression absent, abnormal AB + MO1-apln standard conditions Fig. 6 with image from Zhu et al., 2019
heart primordium lft2 expression absent, abnormal AB + MO1-apln standard conditions Fig. 6 with image from Zhu et al., 2019
heart primordium right side lft2 expression mislocalised, abnormal AB + MO1-apln standard conditions Fig. 6 with image from Zhu et al., 2019
lateral plate mesoderm right side spaw expression mislocalised, abnormal AB + MO1-apln standard conditions Fig. 6 with image from Zhu et al., 2019
determination of left/right asymmetry in lateral mesoderm decreased occurrence, abnormal AB + MO1-apln standard conditions Fig. 6 with image from Zhu et al., 2019
determination of liver left/right asymmetry decreased occurrence, abnormal AB + MO1-apln standard conditions Fig. 5\ with image from Zhu et al., 2019
trunk medial region lft1 expression decreased amount, abnormal AB + MO1-apln standard conditions Fig. 8 with image from Zhu et al., 2019
determination of liver left/right asymmetry process quality, abnormal AB + MO1-apln standard conditions Fig. 5\ with image from Zhu et al., 2019
whole organism medial region shha expression increased amount, abnormal AB + MO1-apln standard conditions Fig. 8 with image from Zhu et al., 2019
Kupffer's vesicle decreased size, abnormal AB + MO1-apln standard conditions Fig. 3,  Fig. 6 with image from Zhu et al., 2019
apoptotic process increased occurrence, abnormal WT + MO1-apln standard conditions Fig. S4 from Zeng et al., 2007
whole organism apoptotic, abnormal WT + MO1-apln standard conditions Fig. S4 from Zeng et al., 2007
mesodermal cell migration disrupted, abnormal WT + MO1-apln standard conditions Fig. 6,  Fig. 7 from Zeng et al., 2007
heart development disrupted, abnormal WT + MO1-apln standard conditions Fig. S4 from Zeng et al., 2007
heart development disrupted, abnormal WT + MO1-apln + MO4-tp53 standard conditions Fig. S4 from Zeng et al., 2007
apoptotic process decreased occurrence, abnormal WT + MO1-apln + MO4-tp53 standard conditions Fig. S4 from Zeng et al., 2007
pericardium edematous, abnormal aplnmu267/+ + MO1-apln standard conditions Fig. S6 with image from Kwon et al., 2016
determination of liver left/right asymmetry decreased occurrence, abnormal as3Tg + MO1-apln standard conditions Fig. 5\ with image from Zhu et al., 2019
determination of liver left/right asymmetry process quality, abnormal as3Tg + MO1-apln standard conditions Fig. 5\ with image from Zhu et al., 2019
heart looping decreased occurrence, abnormal twu34Tg + MO1-apln standard conditions Fig. 5\ with image from Zhu et al., 2019
determination of heart left/right asymmetry process quality, abnormal twu34Tg + MO1-apln standard conditions Fig. 5\ with image from Zhu et al., 2019
parachordal vessel agenesis, abnormal y1Tg + MO1-apln standard conditions Fig. S6 with image from Kwon et al., 2016
parachordal vessel absent, abnormal y7Tg + MO1-apln standard conditions Fig. 2 from Kim et al., 2014
lymph vessel development process quality, abnormal y7Tg + MO1-apln standard conditions Fig. 2 from Kim et al., 2014
parachordal vessel malformed, abnormal y7Tg + MO1-apln standard conditions Fig. 2 from Kim et al., 2014
lymph vessel development process quality, abnormal s896Tg; y7Tg + MO1-apln standard conditions Fig. 2,  Fig. 4,  Fig. 5 from Kim et al., 2014
lymph vessel development process quality, abnormal s896Tg; y7Tg + MO1-apln chemical treatment: torin 1 Fig. 4 from Kim et al., 2014
lymph vessel endothelium endothelial cell decreased amount, abnormal s896Tg; y7Tg + MO1-apln chemical treatment: LY294002 Fig. 4 from Kim et al., 2014
lymph vessel endothelium endothelial cell decreased amount, abnormal s896Tg; y7Tg + MO1-apln standard conditions Fig. 2,  Fig. 4,  Fig. 5 from Kim et al., 2014
lymph vessel development process quality, abnormal s896Tg; y7Tg + MO1-apln chemical treatment: LY294002 Fig. 4 from Kim et al., 2014
lymph vessel endothelium endothelial cell decreased amount, abnormal s896Tg; y7Tg + MO1-apln chemical treatment: torin 1 Fig. 4 from Kim et al., 2014
thoracic duct has fewer parts of type endothelial cell, abnormal s896Tg; y7Tg + MO1-apln standard conditions Fig. 2 from Kim et al., 2014
lymph vessel development process quality, abnormal s896Tg; y7Tg + MO1-apln + MO1-vegfc standard conditions Fig. 5 from Kim et al., 2014
lymph vessel endothelium endothelial cell decreased amount, abnormal s896Tg; y7Tg + MO1-apln + MO1-vegfc standard conditions Fig. 5 from Kim et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.