ZFIN ID: ZDB-MRPHLNO-061117-2
Morpholino Name: MO2-lhx5
Target: lhx5 (1)
Sequence:
5' - GTGCGTTGTTCTCACCTGAATCACC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This targets the third intron splice donor site.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-lhx5 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-lhx5
Expressed Gene Anatomy Figures
lhx5 Fig. S1 with image from Peng et al., 2006
odc1 Fig. S1 with image from Peng et al., 2006
pax2a Fig. S1 with image from Peng et al., 2006
pax6a Fig. S1 with image from Peng et al., 2006
sfrp1a Fig. 5 with image from Peng et al., 2006
PHENOTYPE
Phenotype resulting from MO2-lhx5
No data available

Phenotype of all Fish created by or utilizing MO2-lhx5
No data available
OTHER MO2-lhx5 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)