header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060109-2
Morpholino Name: MO2-rx1
Target: rx1 (1)
Previous Name: rx1GT-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGAAGGACTTACCGTGAAATGTAGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-rx1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-rx1 No data available
PHENOTYPE
Phenotype resulting from MO2-rx1
No data available

Phenotype of all Fish created by or utilizing MO2-rx1
Phenotype Fish Conditions Figures
retinal outer nuclear layer decreased thickness, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 1 with image from Nelson et al., 2009
retina apoptotic, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 6 with image from Nelson et al., 2009
retina lacks all parts of type Muller cell, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 1 with image from Nelson et al., 2009
retina layer formation delayed, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 1 with image from Nelson et al., 2009
neural retina development disrupted, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 5 with image from Nelson et al., 2009
neural retina development delayed, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 4 with image from Nelson et al., 2009
retinal cone cell differentiation disrupted, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 1 with imageFig. 2 with image from Nelson et al., 2009
cell population proliferation disrupted, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 5 with image from Nelson et al., 2009
retinal rod cell differentiation disrupted, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 1 with image from Nelson et al., 2009
cell death increased occurrence, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 6 with image from Nelson et al., 2009
retina layer formation disrupted, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 1 with imageFig. 2 with image from Nelson et al., 2009
retina decreased size, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 1 with image from Nelson et al., 2009
retinal bipolar neuron differentiation disrupted, abnormal WT + MO2-rx1 + MO3-rx1 standard conditions Fig. 1 with image from Nelson et al., 2009
eye photoreceptor cell differentiation disrupted, abnormal WT + MO2-rx1 + MO2-rx2 + MO3-rx1 + MO3-rx2 standard conditions Fig. 11 with image from Nelson et al., 2009
OTHER MO2-rx1 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)