ZFIN ID: ZDB-MRPHLNO-050202-1
Morpholino Name: MO1-neurog1
Target: neurog1 (1)
Previous Names: MO#1 (1), MO7-neurog1, ngn-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ACGATCTCCATTGTTGATAACCTGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-neurog1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-neurog1
Expressed Gene Anatomy Figures
atoh1a Fig. 3 from Sapède et al., 2012
camkvb Fig. 4 with image from Won et al., 2006
gsc Fig. 1 with image from Kantarci et al., 2016
neurod1 Fig. 6 from Sapède et al., 2012
neurod4 Fig. 6 from Sapède et al., 2012
neurog1 Fig. 3 from Sapède et al., 2012
phox2a Fig. 1 with image from Nechiporuk et al., 2005
phox2bb Fig. 1 with image from Nechiporuk et al., 2005
PHENOTYPE
Phenotype resulting from MO1-neurog1
Phenotype Figures
hair cell posterior macula increased amount, abnormal Fig. 3 from Sapède et al., 2012
hair cell posterior macula increased amount, abnormal Fig. 2Fig. 3 from Sapède et al., 2012
opercular lateral line nerve absent, abnormal Fig. 4 with image from Wada et al., 2010
posterior macula increased size, abnormal Fig. 2 from Sapède et al., 2012
ventral anterior lateral line nerve decreased size, abnormal Fig. 4 with image from Wada et al., 2010

Phenotype of all Fish created by or utilizing MO1-neurog1
Phenotype Fish Conditions Figures
hair cell posterior macula increased amount, abnormal WT + MO1-neurog1 standard conditions Fig. 3 from Sapède et al., 2012
opercular lateral line nerve absent, abnormal WT + MO1-neurog1 standard conditions Fig. 4 with image from Wada et al., 2010
ventral anterior lateral line nerve decreased size, abnormal WT + MO1-neurog1 standard conditions Fig. 4 with image from Wada et al., 2010
posterior macula increased size, abnormal s356tTg + MO1-neurog1 standard conditions Fig. 2 from Sapède et al., 2012
hair cell posterior macula increased amount, abnormal s356tTg + MO1-neurog1 standard conditions Fig. 2Fig. 3 from Sapède et al., 2012
dorsal root ganglion decreased amount, abnormal sox10t3/t3 + MO1-neurog1 standard conditions Fig. 5 with image from Carney et al., 2006
OTHER MO1-neurog1 MORPHOLINO PAGESNo links to external sites
CITATIONS (13)