Morpholino

MO1-ambra1b

ID
ZDB-MRPHLNO-140918-3
Name
MO1-ambra1b
Previous Names
None
Target
Sequence
5' - TTTTCCTCTTTAGTGCTCCACGGCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ambra1b
Phenotype
Phenotype resulting from MO1-ambra1b
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal WT + MO1-ambra1b Fig. 12 from Benato et al., 2013
autophagy decreased process quality, abnormal WT + MO1-ambra1b Fig. 11 from Benato et al., 2013
cell population proliferation increased occurrence, abnormal AB + MO1-ambra1b Fig. 4 with image from Meneghetti et al., 2020
Fig. 5 with image from Skobo et al., 2014
embryo development disrupted, abnormal WT + MO1-ambra1b Fig. 1 with image from Skobo et al., 2014
Fig. 6 from Benato et al., 2013
embryonic heart tube development disrupted, abnormal WT + MO1-ambra1b Fig. 1 with imageFig. 2 with image from Meneghetti et al., 2020
embryonic heart tube left/right pattern formation disrupted, abnormal WT + MO1-ambra1b Fig. 2 with image from Meneghetti et al., 2020
eye decreased size, abnormal WT + MO1-ambra1b + MO4-tp53 Fig. 6Fig. 7Fig. 8 from Benato et al., 2013
fourth ventricle hydrocephalic, abnormal WT + MO1-ambra1b Fig. 7 from Benato et al., 2013
hatching disrupted, abnormal AB + MO1-ambra1b Fig. S3 with image from Skobo et al., 2014
head apoptotic, abnormal WT + MO1-ambra1b Fig. 12 from Benato et al., 2013
head decreased size, abnormal WT + MO1-ambra1b + MO4-tp53 Fig. 6 from Benato et al., 2013
heart edematous, abnormal WT + MO1-ambra1b Fig. 1 with image from Meneghetti et al., 2020
heart looping disrupted, abnormal WT + MO1-ambra1b Fig. 2 with image from Meneghetti et al., 2020
heart tube malformed, abnormal WT + MO1-ambra1b Fig. 1 with imageFig. 2 with image from Meneghetti et al., 2020
intersegmental vessel morphology, abnormal WT + MO1-ambra1b Fig. S3 from Benato et al., 2013
muscle disorganized, abnormal AB + MO1-ambra1b Fig. 7 with image from Skobo et al., 2014
muscle mitochondrion morphology, abnormal AB + MO1-ambra1b Fig. 8 with image from Skobo et al., 2014
muscle sarcomere decreased amount, abnormal AB + MO1-ambra1b Fig. 7 with image from Skobo et al., 2014
muscle sarcomere disorganized, abnormal AB + MO1-ambra1b Fig. 7 with image from Skobo et al., 2014
muscle sarcoplasmic reticulum dilated, abnormal AB + MO1-ambra1b Fig. 8 with image from Skobo et al., 2014
muscle striated muscle thin filament separated from muscle myosin filament, abnormal AB + MO1-ambra1b Fig. 8 with image from Skobo et al., 2014
muscle cell degenerate, abnormal AB + MO1-ambra1b Fig. 7 with image from Skobo et al., 2014
muscle cell disorganized, abnormal AB + MO1-ambra1b Fig. 3 with imageFig. 8 with imageFig. 9 with image from Skobo et al., 2014
muscle cell nucleus increased amount, abnormal AB + MO1-ambra1b Fig. 3 with image from Skobo et al., 2014
muscle cell nucleus morphology, abnormal AB + MO1-ambra1b Fig. 4 with imageFig. 8 with image from Skobo et al., 2014
myoseptum morphology, abnormal AB + MO1-ambra1b Fig. 3 with imageFig. 9 with image from Skobo et al., 2014
myoseptum unstructured, abnormal AB + MO1-ambra1b Fig. 4 with image from Skobo et al., 2014
myosin filament organization disrupted, abnormal AB + MO1-ambra1b Fig. 9 with image from Skobo et al., 2014
notochord disorganized, abnormal WT + MO1-ambra1b Fig. 7 from Benato et al., 2013
otolith decreased size, abnormal WT + MO1-ambra1b + MO4-tp53 Fig. 6 from Benato et al., 2013
pericardium edematous, abnormal WT + MO1-ambra1b Fig. 8 from Benato et al., 2013
pigmentation delayed, abnormal WT + MO1-ambra1b Fig. 6 from Benato et al., 2013
post-vent region curved, abnormal AB + MO1-ambra1b Fig. 1 with image from Skobo et al., 2014
post-vent region deformed, abnormal WT + MO1-ambra1b Fig. 7 from Benato et al., 2013
post-vent region kinked, abnormal WT + MO1-ambra1b + MO4-tp53 Fig. 6 from Benato et al., 2013
primordial germ cell decreased amount, abnormal WT + MO1-ambra1b Fig. 3 with image from Fontana et al., 2023
Rohon-Beard neuron mislocalised, abnormal WT + MO1-ambra1b Fig. 2 with image from Meneghetti et al., 2020
skeletal myofibril assembly disrupted, abnormal AB + MO1-ambra1b Fig. 9 with image from Skobo et al., 2014
somite shape, abnormal AB + MO1-ambra1b Fig. 9 with image from Skobo et al., 2014
subintestinal vein morphology, abnormal WT + MO1-ambra1b Fig. S3 from Benato et al., 2013
swimming process quality, abnormal AB + MO1-ambra1b Fig. S4 with image from Skobo et al., 2014
tectal ventricle hydrocephalic, abnormal WT + MO1-ambra1b Fig. 7 from Benato et al., 2013
thigmotaxis disrupted, abnormal AB + MO1-ambra1b Fig. S4 with image from Skobo et al., 2014
trunk decreased size, abnormal WT + MO1-ambra1b Fig. 6 from Benato et al., 2013
trunk musculature muscle cell disorganized, abnormal AB + MO1-ambra1b Fig. 4 with image from Skobo et al., 2014
whole organism dead, abnormal WT + MO1-ambra1b text only from Benato et al., 2013
whole organism decreased size, abnormal AB + MO1-ambra1b Fig. 1 with image from Skobo et al., 2014
whole organism deformed, abnormal WT + MO1-ambra1b + MO4-tp53 Fig. 6 from Benato et al., 2013
whole organism refractivity, abnormal AB + MO1-ambra1b Fig. 1 with image from Skobo et al., 2014
yolk syncytial layer edematous, abnormal WT + MO1-ambra1b Fig. 8 from Benato et al., 2013
Phenotype of all Fish created by or utilizing MO1-ambra1b
Phenotype Fish Conditions Figures
muscle sarcomere decreased amount, abnormal AB + MO1-ambra1b standard conditions Fig. 7 with image from Skobo et al., 2014
muscle cell degenerate, abnormal AB + MO1-ambra1b standard conditions Fig. 7 with image from Skobo et al., 2014
embryo development disrupted, abnormal AB + MO1-ambra1b standard conditions Fig. 1 with image from Skobo et al., 2014
myoseptum unstructured, abnormal AB + MO1-ambra1b standard conditions Fig. 4 with image from Skobo et al., 2014
trunk musculature muscle cell disorganized, abnormal AB + MO1-ambra1b standard conditions Fig. 4 with image from Skobo et al., 2014
muscle sarcomere disorganized, abnormal AB + MO1-ambra1b standard conditions Fig. 7 with image from Skobo et al., 2014
whole organism refractivity, abnormal AB + MO1-ambra1b standard conditions Fig. 1 with image from Skobo et al., 2014
muscle striated muscle thin filament separated from muscle myosin filament, abnormal AB + MO1-ambra1b standard conditions Fig. 8 with image from Skobo et al., 2014
swimming process quality, abnormal AB + MO1-ambra1b standard conditions Fig. S4 with image from Skobo et al., 2014
thigmotaxis disrupted, abnormal AB + MO1-ambra1b standard conditions Fig. S4 with image from Skobo et al., 2014
muscle mitochondrion morphology, abnormal AB + MO1-ambra1b standard conditions Fig. 8 with image from Skobo et al., 2014
muscle disorganized, abnormal AB + MO1-ambra1b standard conditions Fig. 7 with image from Skobo et al., 2014
cell population proliferation increased occurrence, abnormal AB + MO1-ambra1b standard conditions Fig. 5 with image from Skobo et al., 2014
somite shape, abnormal AB + MO1-ambra1b standard conditions Fig. 9 with image from Skobo et al., 2014
whole organism decreased size, abnormal AB + MO1-ambra1b standard conditions Fig. 1 with image from Skobo et al., 2014
hatching disrupted, abnormal AB + MO1-ambra1b standard conditions Fig. S3 with image from Skobo et al., 2014
muscle cell nucleus morphology, abnormal AB + MO1-ambra1b standard conditions Fig. 4 with imageFig. 8 with image from Skobo et al., 2014
skeletal myofibril assembly disrupted, abnormal AB + MO1-ambra1b standard conditions Fig. 9 with image from Skobo et al., 2014
muscle cell disorganized, abnormal AB + MO1-ambra1b standard conditions Fig. 3 with imageFig. 8 with imageFig. 9 with image from Skobo et al., 2014
myoseptum morphology, abnormal AB + MO1-ambra1b standard conditions Fig. 3 with imageFig. 9 with image from Skobo et al., 2014
myosin filament organization disrupted, abnormal AB + MO1-ambra1b standard conditions Fig. 9 with image from Skobo et al., 2014
post-vent region curved, abnormal AB + MO1-ambra1b standard conditions Fig. 1 with image from Skobo et al., 2014
muscle sarcoplasmic reticulum dilated, abnormal AB + MO1-ambra1b standard conditions Fig. 8 with image from Skobo et al., 2014
muscle cell nucleus increased amount, abnormal AB + MO1-ambra1b standard conditions Fig. 3 with image from Skobo et al., 2014
embryonic heart tube development disrupted, abnormal WT + MO1-ambra1b standard conditions Fig. 1 with imageFig. 2 with image from Meneghetti et al., 2020
primordial germ cell decreased amount, abnormal WT + MO1-ambra1b control Fig. 3 with image from Fontana et al., 2023
yolk syncytial layer edematous, abnormal WT + MO1-ambra1b standard conditions Fig. 8 from Benato et al., 2013
head decreased size, abnormal WT + MO1-ambra1b standard conditions Fig. 6 from Benato et al., 2013
trunk decreased size, abnormal WT + MO1-ambra1b standard conditions Fig. 6 from Benato et al., 2013
subintestinal vein morphology, abnormal WT + MO1-ambra1b standard conditions Fig. S3 from Benato et al., 2013
intersegmental vessel morphology, abnormal WT + MO1-ambra1b standard conditions Fig. S3 from Benato et al., 2013
fourth ventricle hydrocephalic, abnormal WT + MO1-ambra1b standard conditions Fig. 7 from Benato et al., 2013
Rohon-Beard neuron mislocalised, abnormal WT + MO1-ambra1b standard conditions Fig. 2 with image from Meneghetti et al., 2020
autophagy decreased process quality, abnormal WT + MO1-ambra1b standard conditions Fig. 11 from Benato et al., 2013
tectal ventricle hydrocephalic, abnormal WT + MO1-ambra1b standard conditions Fig. 7 from Benato et al., 2013
otolith decreased size, abnormal WT + MO1-ambra1b standard conditions Fig. 6 from Benato et al., 2013
pericardium edematous, abnormal WT + MO1-ambra1b standard conditions Fig. 8 from Benato et al., 2013
cell population proliferation increased occurrence, abnormal WT + MO1-ambra1b standard conditions Fig. 4 with image from Meneghetti et al., 2020
apoptotic process increased occurrence, abnormal WT + MO1-ambra1b standard conditions Fig. 12 from Benato et al., 2013
heart tube malformed, abnormal WT + MO1-ambra1b standard conditions Fig. 1 with imageFig. 2 with image from Meneghetti et al., 2020
post-vent region kinked, abnormal WT + MO1-ambra1b standard conditions Fig. 6 from Benato et al., 2013
whole organism dead, abnormal WT + MO1-ambra1b standard conditions text only from Benato et al., 2013
heart edematous, abnormal WT + MO1-ambra1b standard conditions Fig. 1 with image from Meneghetti et al., 2020
whole organism deformed, abnormal WT + MO1-ambra1b standard conditions Fig. 6 from Benato et al., 2013
heart looping disrupted, abnormal WT + MO1-ambra1b standard conditions Fig. 2 with image from Meneghetti et al., 2020
notochord disorganized, abnormal WT + MO1-ambra1b standard conditions Fig. 7 from Benato et al., 2013
post-vent region deformed, abnormal WT + MO1-ambra1b standard conditions Fig. 7 from Benato et al., 2013
head apoptotic, abnormal WT + MO1-ambra1b standard conditions Fig. 12 from Benato et al., 2013
embryonic heart tube left/right pattern formation disrupted, abnormal WT + MO1-ambra1b standard conditions Fig. 2 with image from Meneghetti et al., 2020
embryo development disrupted, abnormal WT + MO1-ambra1b standard conditions Fig. 6 from Benato et al., 2013
pigmentation delayed, abnormal WT + MO1-ambra1b standard conditions Fig. 6 from Benato et al., 2013
eye decreased size, abnormal WT + MO1-ambra1b standard conditions Fig. 6Fig. 7Fig. 8 from Benato et al., 2013
head decreased size, abnormal WT + MO1-ambra1b + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
post-vent region kinked, abnormal WT + MO1-ambra1b + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
whole organism deformed, abnormal WT + MO1-ambra1b + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
eye decreased size, abnormal WT + MO1-ambra1b + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
trunk decreased size, abnormal WT + MO1-ambra1b + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
pigmentation delayed, abnormal WT + MO1-ambra1b + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
otolith decreased size, abnormal WT + MO1-ambra1b + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
embryo development disrupted, abnormal WT + MO1-ambra1b + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
muscle cell degenerate, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 7 with image from Skobo et al., 2014
muscle sarcomere decreased amount, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 7 with image from Skobo et al., 2014
muscle sarcomere disorganized, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 7 with image from Skobo et al., 2014
trunk musculature muscle cell disorganized, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 4 with image from Skobo et al., 2014
myoseptum unstructured, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 4 with image from Skobo et al., 2014
muscle cell nucleus morphology, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 4 with imageFig. 8 with image from Skobo et al., 2014
muscle cell disorganized, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 3 with imageFig. 8 with imageFig. 9 with image from Skobo et al., 2014
somite morphology, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 2 with image from Skobo et al., 2014
skeletal myofibril assembly disrupted, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 9 with image from Skobo et al., 2014
hatching disrupted, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. S3 with image from Skobo et al., 2014
muscle striated muscle thin filament separated from muscle myosin filament, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 8 with image from Skobo et al., 2014
swimming process quality, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. S4 with image from Skobo et al., 2014
muscle mitochondrion morphology, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 8 with image from Skobo et al., 2014
thigmotaxis disrupted, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. S4 with image from Skobo et al., 2014
muscle disorganized, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 7 with image from Skobo et al., 2014
cell population proliferation increased occurrence, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 5 with image from Skobo et al., 2014
somite shape, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 9 with image from Skobo et al., 2014
myoseptum morphology, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 3 with imageFig. 9 with image from Skobo et al., 2014
notochord undulate, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 2 with image from Skobo et al., 2014
myosin filament organization disrupted, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 9 with image from Skobo et al., 2014
whole organism anterior-posterior axis shortened, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 2 with image from Skobo et al., 2014
muscle cell nucleus increased amount, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 3 with image from Skobo et al., 2014
muscle sarcoplasmic reticulum dilated, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 8 with image from Skobo et al., 2014
heart tube malformed, exacerbated WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 1 with image from Meneghetti et al., 2020
head decreased size, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 6 from Benato et al., 2013
eye decreased size, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 6Fig. 7Fig. 8 from Benato et al., 2013
fourth ventricle hydrocephalic, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 7 from Benato et al., 2013
whole organism deformed, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 6 from Benato et al., 2013
whole organism decreased size, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 1 with image from Skobo et al., 2014
otic vesicle decreased size, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 8 from Benato et al., 2013
embryo development disrupted, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 1 with image from Skobo et al., 2014
Fig. 6 from Benato et al., 2013
otolith decreased size, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 6 from Benato et al., 2013
embryonic heart tube development disrupted, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 1 with image from Meneghetti et al., 2020
heart edematous, exacerbated WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 1 with image from Meneghetti et al., 2020
notochord disorganized, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 7 from Benato et al., 2013
whole organism refractivity, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 1 with image from Skobo et al., 2014
head apoptotic, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 12 from Benato et al., 2013
post-vent region curved, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 1 with image from Skobo et al., 2014
apoptotic process increased occurrence, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 12 from Benato et al., 2013
intersegmental vessel morphology, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. S3 from Benato et al., 2013
eye adjacent to eye, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 8 from Benato et al., 2013
tectal ventricle hydrocephalic, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 7 from Benato et al., 2013
subintestinal vein morphology, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. S3 from Benato et al., 2013
post-vent region kinked, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 6 from Benato et al., 2013
post-vent region deformed, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 7 from Benato et al., 2013
embryonic heart tube development disrupted, abnormal ambra1aia35 + MO1-ambra1b standard conditions Fig. 3 with image from Meneghetti et al., 2020
embryonic heart tube left/right pattern formation disrupted, abnormal ambra1aia35 + MO1-ambra1b standard conditions Fig. 3 with image from Meneghetti et al., 2020
heart looping disrupted, abnormal ambra1aia35 + MO1-ambra1b standard conditions Fig. 3 with image from Meneghetti et al., 2020
Citations