CRISPR

CRISPR3-mafba

ID
ZDB-CRISPR-221101-2
Name
CRISPR3-mafba
Previous Names
None
Target
Sequence
5' - GCACGGGGTGCTGATAGGAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
hzu17 mafba
Expression
Gene expression in Wild Types + CRISPR3-mafba
No data available
Phenotype
Phenotype resulting from CRISPR3-mafba
No data available
Phenotype of all Fish created by or utilizing CRISPR3-mafba
Phenotype Fish Conditions Figures
keratinocyte progenitor cell apoptotic process decreased rate, abnormal mafbahzu17/hzu17 standard conditions Figure 5 with image from Chen et al., 2021
head mdm2 expression increased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 7 with image from Chen et al., 2021
inner ear ionocyte atp6v1aa expression decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 6 with image from Chen et al., 2021
head cdkn3 expression increased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 7 with image from Chen et al., 2021
head dhfr expression decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 7 with image from Chen et al., 2021
inner ear NaK ionocyte atp1b2b expression decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 6 with image from Chen et al., 2021
head ccne1 expression decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 7 with image from Chen et al., 2021
head cul3a expression increased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 7 with image from Chen et al., 2021
NaK ionocyte decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 6 with image from Chen et al., 2021
head cdk4 expression decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 7 with image from Chen et al., 2021
head ab4-h2afx labeling increased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 8 with image from Chen et al., 2021
head tp53 expression increased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 7 with image from Chen et al., 2021
otolith decreased area, abnormal mafbahzu17/hzu17 standard conditions Figure 2 with image from Chen et al., 2021
vH ionocyte decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 6 with image from Chen et al., 2021
head ab2-atr labeling increased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 8 with image from Chen et al., 2021
inner ear vH ionocyte Ab6-atp6v1a labeling decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 6 with image from Chen et al., 2021
startle response decreased process quality, abnormal mafbahzu17/hzu17 vibration Figure 3 with image from Chen et al., 2021
head foxa1 expression decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 7 with image from Chen et al., 2021
epidermal stem cell apoptotic process decreased rate, abnormal mafbahzu17/hzu17 standard conditions Figure 5 with image from Chen et al., 2021
vH ionocyte apoptotic process increased rate, abnormal mafbahzu17/hzu17 standard conditions Figure 6 with image from Chen et al., 2021
head mycb expression decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 7 with image from Chen et al., 2021
epidermal stem cell ab1-tp63 labeling decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 4 with imageFigure 5 with image from Chen et al., 2021
head baxa expression increased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 7 with image from Chen et al., 2021
inner ear NaK ionocyte atp1b1a expression decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 6 with image from Chen et al., 2021
head cdkn1bb expression increased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 7 with image from Chen et al., 2021
head cdk2 expression decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 7 with image from Chen et al., 2021
head Ab2-mafba labeling decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 1 with image from Chen et al., 2021
ionocyte cell population proliferation decreased rate, abnormal mafbahzu17/hzu17 standard conditions Figure 4 with image from Chen et al., 2021
epidermal stem cell cell population proliferation decreased rate, abnormal mafbahzu17/hzu17 standard conditions Figure 4 with image from Chen et al., 2021
inner ear vH ionocyte atp6v1aa expression decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 6 with image from Chen et al., 2021
ionocyte progenitor cell foxi3a expression decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 4 with image from Chen et al., 2021
inner ear ionocyte atp1a1a.4 expression decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 6 with image from Chen et al., 2021
head mdm4 expression decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 7 with image from Chen et al., 2021
head ccnd1 expression decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 7 with image from Chen et al., 2021
head mafba expression decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 1 with image from Chen et al., 2021
head e2f1 expression decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 7 with image from Chen et al., 2021
head Ab4-atm labeling increased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 8 with image from Chen et al., 2021
otolith lumen increased area, abnormal mafbahzu17/hzu17 standard conditions Figure 2 with image from Chen et al., 2021
head cdkn1a expression increased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 7 with image from Chen et al., 2021
ionocyte progenitor cell dlc expression decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 4 with image from Chen et al., 2021
inner ear ionocyte atp1b2b expression decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 6 with image from Chen et al., 2021
head casp8 expression increased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 7 with image from Chen et al., 2021
NaK ionocyte apoptotic process increased rate, abnormal mafbahzu17/hzu17 standard conditions Figure 6 with image from Chen et al., 2021
ionocyte apoptotic process decreased rate, abnormal mafbahzu17/hzu17 standard conditions Figure 5 with image from Chen et al., 2021
head bbc3 expression increased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 7 with image from Chen et al., 2021
head rangap1a expression decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 7 with image from Chen et al., 2021
ionocyte apoptotic process increased rate, abnormal mafbahzu17/hzu17 standard conditions Figure 6 with imageFigure 8 with image from Chen et al., 2021
ionocyte progenitor cell foxi3b expression decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 4 with image from Chen et al., 2021
head bcl2a expression decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 7 with image from Chen et al., 2021
head tk1 expression decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 7 with image from Chen et al., 2021
head e2f3 expression decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 7 with image from Chen et al., 2021
head cdkn2a/b expression increased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 7 with image from Chen et al., 2021
inner ear ionocyte ab4-h2afx labeling increased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 8 with image from Chen et al., 2021
inner ear NaK ionocyte atp1a1a.4 expression decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 6 with image from Chen et al., 2021
head cul1a expression increased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 7 with image from Chen et al., 2021
head rb1 expression decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 7 with image from Chen et al., 2021
keratinocyte progenitor cell cell population proliferation decreased rate, abnormal mafbahzu17/hzu17 standard conditions Figure 4 with image from Chen et al., 2021
inner ear ionocyte atp1b1a expression decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 6 with image from Chen et al., 2021
head cdk6 expression decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 7 with image from Chen et al., 2021
head casp10 expression increased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 7 with image from Chen et al., 2021
cell cycle phase transition decreased process quality, abnormal mafbahzu17/hzu17 standard conditions Figure 7 with image from Chen et al., 2021
ionocyte progenitor cell ab2-dlc labeling decreased amount, abnormal mafbahzu17/hzu17 standard conditions Figure 4 with imageFigure 5 with image from Chen et al., 2021
retinal rod cell EGFP expression decreased distribution, abnormal mafbahzu17/+; nrlhzu16/hzu16; kj2Tg standard conditions Fig 8 with image from Liu et al., 2022
retinal rod cell decreased amount, abnormal mafbahzu17/+; nrlhzu16/hzu16; kj2Tg standard conditions Fig 8 with image from Liu et al., 2022
retinal rod cell absence of anatomical entity, abnormal mafbahzu17/hzu17; nrlhzu16/hzu16; kj2Tg standard conditions Fig 8 with image from Liu et al., 2022
retinal rod cell EGFP expression absent, abnormal mafbahzu17/hzu17; nrlhzu16/hzu16; kj2Tg standard conditions Fig 8 with image from Liu et al., 2022
whole organism dead, abnormal mafbahzu17/hzu17; nrlhzu16/hzu16; kj2Tg standard conditions text only from Liu et al., 2022
Citations