| ZFIN ID: ZDB-SSLP-980528-9 | 
| SSLP: | z3399 | 
|---|
PHYSICAL MAP AND BROWSER
                    
                    
                        No data available
                    
                
            
        
    
    
PHYSICAL MAPPING 
                    
                    
                        No data available
                    
                
            
        
    
    
| Chr | Location | Mapped As | Panel | Mapped By | Scoring | 
|---|---|---|---|---|---|
| 24 | 44.1 cM | z3399 | Boston MGH Cross (MGH) | Fishman, Mark C. | Data | 
| 24 | 2907.0 cR | z3399 | Goodfellow T51 (T51) | Geisler, Robert | Data | 
| 24 | 61.6 cM | z3399 | Heat Shock (HS) | Woods, Ian G. | Data | 
| 24 | 28.5 cM | Gates et al (GAT) | Talbot, William S. | Data | |
| Note: Physical map location as
            displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. | |||||
| Marker | Type | Chr | Distance | Publication / Person | Comments | 
|---|---|---|---|---|---|
| ts213 | Feature | 24 | Knight et al., 2003 | Knight et al. (2003, Development 130:5755-5768) report mapping mobts213 between z23011 and z3399 on a meiotic map. This corresponds to the map position of tfap2a that also maps between z23011 and z3399. | |
| z23011 | SSLP | 24 | Knight et al., 2003 | Knight et al. (2003, Development 130:5755-5768) report mapping mobts213 between z23011 and z3399 on a meiotic map. This corresponds to the map position of tfap2a that also maps between z23011 and z3399. | |
| flt3 | GENE | 24 | 0.0 cM | Phillips et al., 2006 | |
| arxa | GENE | 24 | 2.5 cM | Phillips et al., 2006 | |
| b458 | Feature | 24 | Rodino-Klapac et al., 2004 | Rodino-Klapac and Beattie report (2004, Dev. Biol. 273(2):308-320) that toppedb458 located on LG 24 and is linked to SSLP markers z58867 and z3399. | |
| z58867 | SSLP | 24 | Rodino-Klapac et al., 2004 | Rodino-Klapac and Beattie report (2004, Dev. Biol. 273(2):308-320) that toppedb458 located on LG 24 and is linked to SSLP markers z58867 and z3399. | 
| 
 | 
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] | 
|---|---|---|---|
| IND | NA | ||
| Forward Primer | CTCCTAGGGTGCTCCGCCTT | ||
| Reverse Primer | ACAGCAGATGCCCTTCCAGC | ||
| AB | NA | ||
| Forward Primer | CTCCTAGGGTGCTCCGCCTT | ||
| Reverse Primer | ACAGCAGATGCCCTTCCAGC | 
