header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-GENE-980526-561

Mapping Details

Gene Name: myogenic differentiation 1
Symbol: myod1
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position
ZFIN Gbrowse 25 31,421,253 - 31,423,493
Ensembl 25 31,421,253 - 31,423,493
Vega 25 30,843,777 - 30,846,017
NCBI Map Viewer 25 31,421,253 - 31,423,459
UCSC 25 -
Mapped Clones containing myod1
CH211-201M7 Chr: 25 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Citations
hu2023 25 31,422,131 GRCz11 Busch-Nentwich et al., 2013
25 30,844,655 GRCz10 Busch-Nentwich et al., 2013
25 32,265,402 Zv9 Busch-Nentwich et al., 2013
hu2024 25 31,421,995 GRCz11 Busch-Nentwich et al., 2013
25 30,844,519 GRCz10 Busch-Nentwich et al., 2013
25 32,265,266 Zv9 Busch-Nentwich et al., 2013

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
25 114.3cM myod Mother of Pearl (MOP) Postlethwait, John H. Data
25 365.81cR myod Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
25 3341.0cR myod Goodfellow T51 (T51) Geisler, Robert Data
25 72.5cM myod Heat Shock (HS) Woods, Ian G. Data
25 76.6cM myod Gates et al (GAT) Talbot, William S. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
lamb1a GENE 25 20.0cR Parsons et al., 2002 Parsons, et al. (2002. Dev 129:3137-3146.) report mapping lamb1 to LG25  ...
lamb4 GENE 25 Parsons et al., 2002 Parsons, et al. (2002. Dev 129:3137-3146.) report mapping lamb1 to LG25  ...

OTHER MAPPING INFORMATION
Markers Encoded by myod1
fb57a01Chr: 25 Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 750 DdeI 36.0
Forward Primer ATGAGGGATCTGTCCTGAGTG
Reverse Primer TTGTTCGTTTTCGTCGCTTT