Transcript

ptp4a1-208

ID
ZDB-TSCRIPT-160112-443
Name
ptp4a1-208
Previous Names
  • ptp4a1-006
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062648 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062648|OTTDARG00000034922| ptp4a1|OTTDARP00000048985 ptp4a1-006 LG_ BX324177.48 Danio rerio protein_coding KNOWN, 821 bp
ACACACGGCAGCGCTGTATGGTCAAACACCACAACAATTA
TTCTCCTGGACGGCTTCATGATTAAGCTACAATCTTCAAT
GAGTAAGCATATTCCATTCTGTGGTGTTTTGGGTCACACA
TTTATGGAGTTTCTGAAGGGCAGTGGGGATTACTGCCAGG
CTCAGCACGGCGTTTATGCAGAGAAGTGAACGGCTAGCCT
CGCTACCTCATCAGAAGAGAGACTTGTGTTACAGTTTTAA
CGTTGGCGGGTTCAGGCTTGGAGAGCAGGCGTCCACATCG
GTCGGCGGTCCTGGATGGGGTAAAAAAAATCTCTTGAAGT
GCACTGCCCTCGTCGGCCCTTCGTCTTCACTCTCACCAGA
GGACCAGCCTCCTTTTTTCTTTTCTTTTGTGATTGATTTT
TTTCCACCCTCTTTCCTATTTCATTTTTGTTGTTTTGTCC
TTAACTTTTAATCCTGCCCACCTCTGGCTCACACCTCATT
TCCTAATTACATCCGCCAGAGTTTCTTTAATCTTCTGTTA
CTGGAGAGAGTTTCTCCCATATTTTTTTTCAAGATTTTCA
AGCTCTATTGCAAAGTCAAAAATGGCTCGTATGAATAGAC
CTGCCCCAGTGGAGATCACTTACAAAAACATGAGATTCCT
CATTACCCACAATCCCACTAATGCCACGCTTCACAAATTC
ATCGAGGAACTGAAGAAATATGGGGTGACAACGGTTGTTA
GAGTGTGCGAGGCCACGTATGATGCAAACCTGGTTGTCAA
GGAGGGCATTCAGGTTCTGGATTGGCCCTTTGATGATGGA
GCTCCTCCCTCCAACCAGATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations