Transcript

ptp4a1-205

ID
ZDB-TSCRIPT-141209-3208
Name
ptp4a1-205
Previous Names
  • ptp4a1-005
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060781 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060781|OTTDARG00000034922|ZDB-GENE-041121-11 ptp4a1|OTTDARP00000046969 ptp4a1-005 LG_ BX324177.48 Danio rerio protein_coding KNOWN, 806 bp
TTCAAGCTCTATTGCAAAGTCAAAAATGGCTCGTATGAAT
AGACCTGCCCCAGTGGAGATCACTTACAAAAACATGAGAT
TCCTCATTACCCACAATCCCACTAATGCCACGCTTCACAA
ATTCATCGAGGAACTGAAGAAATATGGGGTGACAACGGTT
GTTAGAGTGTGCGAGGCCACGTATGATGCAAACCTGGTTG
TCAAGGAGGGCATTCAGGTTCTGGATTGGCCCTTTGATGA
TGGAGCTCCTCCCTCCAACCAGATTGTTGATGATTGGCTG
AATCTTCTTCGGGTTAAGTTCAGGGAGGAGCCAGGATGCT
GCATTGCCGTGCATTGTGTGGCAGGCCTTGGAAGAGCCCC
AGTGCTGGTTGCCCTGGCCCTGATTGAGTGTGGGATGAAG
TATGAGGATGCTGTTCAATTCATTCGACAAAAGCGGCGTG
GAGCATTTAACAGCAAGCAGCTTTTCTACCTGGAAAAATA
TCGTCCCAAAATGCGTCTTCGATTCAAGGATTCCAACGGA
CATCGCACCAACTGCTGCATTCATGTCCCATTCCCTCCTC
TTCATTTCTGTATTTCCTGTGGAGAACCTCTGTCAGCAAG
GTGAAGTGCTTGTTTGATGAACATGAGCTTAGTGTTTTGC
GAGGAAGTCGGTTGGTGAACATGGTCAAATCCCGCCTCTG
CCAAACTCGTACAGAAAGACACCGTCTGGTGGAGGAGTTC
TCAATGGCATTTGGAGAGGGTTCTTGATGTCTTTTGCAGA
AAAAAAAATAGGAAGAGATTCTGAAGAAAAATCAAGGAAA
AAGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations