Transcript

ptp4a1-007

ID
ZDB-TSCRIPT-160112-125
Name
ptp4a1-007
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062647 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062647|OTTDARG00000034922| ptp4a1|no_translation ptp4a1-007 LG_ BX324177.48 Danio rerio protein_coding KNOWN, 942 bp
ACACACACGGCAGCGCTGTATGGTCAAACACCACAACAAT
TATTCTCCTGGACGGCTTCATGATTAAGCTACAATCTTCA
ATGAGTAAGCATATTCCACAGTTCTGTGGTGTTTTGGGTC
ACACATTTATGGAGTTTCTGAAGGGCAGTGGGGATTACTG
CCAGGCTCAGCACGGCGTTTATGCAGAGAAGTGAACGGCT
AGCCTCGCTACCTCATCAGAAGAGAGACTTGTGTTACAGT
TTTAACGTTGGCGGGTTCAGGCTTGGAGAGCAGGCGTCCA
CATCGGTCGGCGGTCCTGGATGGGGTAAAAAAAATCTCTT
GAAGTGCACTGCCCTCGTCGGCCCTTCGTCTTCACTCTCA
CCAGAGGACCAGCCTCCTTTTTTCTTTTCTTTTGTGATTG
ATTTTTTTCCACCCTCTTTCCTATTTCATTTTTGTTGTTT
TGTCCTTAACTTTTAATCCTGCCCACCTCTGGCTCACACC
TCATTTCCTAATTACATCCGCCAGAGTTTCTTTAATCTTC
TGTTACTGGAGAGAGTTTCTCCCATATTTTTTTTCAAGAT
TTTCAAGCTCTATTGCAAAGTCAAAAATGGCTCGTATGAA
TAGACCTGCCCCAGTGGAGATCACTTACAAAAACATGAGA
TTCCTCATTACCCACAATCCCACTAATGCCACGCTTCACA
AATTCATCGAGGTGAGTTCCAATAGCTCGAACTTTCTGAA
AGTGATGTTTGCATGGACAATTATAAAAAGCTCTTGATTA
CACCCTTTTCCCAATCGCAAAACTTTGACTGTTATTTGAC
TTCATATCAAATAACTGCAAAATATCACACATCACTGTCT
TCCATCAGGAACTGAAGAAATATGGGGTGACAACGGTTGT
TAGAGTGTGCGAGGCCACGTATGATGCAAACCTGGTTGTC
AAGGAGGGCATTCAGGTTCTGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations