Transcript

ptp4a1-201

ID
ZDB-TSCRIPT-110325-2376
Name
ptp4a1-201
Previous Names
  • ptp4a1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049585 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049585|OTTDARG00000034922|ZDB-GENE-041121-11 ptp4a1|OTTDARP00000038899 ptp4a1-001 LG_ BX324177.48 Danio rerio protein_coding KNOWN, 2002 bp
GTGTGTGTGTGTGTGTTGTAGGGTGCGGTTTCTTGAGTCC
AGCTGTAACCGGTTAACTGTTACCGGAGACTCTCATCACA
CACACGGCAGCGCTGTATGGTCAAACACCACAACAATTAT
TCTCCTGGACGGCTTCATGATTAAGCTACAATCTTCAATG
AGTAAGCATATTCCACAGTTCTGTGGTGTTTTGGGTCACA
CATTTATGGAGTTTCTGAAGGGCAGTGGGGATTACTGCCA
GGCTCAGCACGGCGTTTATGCAGAGAAGTGAACGGCTAGC
CTCGCTACCTCATCAGAAGAGAGACTTGTGTTACAGTTTT
AACGTTGGCGGGTTCAGGCTTGGAGAGCAGGCGTCCACAT
CGGTCGGCGGTCCTGGATGGGGTAAAAAAAATCTCTTGAA
GTGCACTGCCCTCGTCGGCCCTTCGTCTTCACTCTCACCA
GAGGACCAGCCTCCTTTTTTCTTTTCTTTTGTGATTGATT
TTTTTCCACCCTCTTTCCTATTTCATTTTTGTTGTTTTGT
CCTTAACTTTTAATCCTGCCCACCTCTGGCTCACACCTCA
TTTCCTAATTACATCCGCCAGAGTTTCTTTAATCTTCTGT
TACTGGAGAGAGTTTCTCCCATATTTTTTTTCAAGATTTT
CAAGCTCTATTGCAAAGTCAAAAATGGCTCGTATGAATAG
ACCTGCCCCAGTGGAGATCACTTACAAAAACATGAGATTC
CTCATTACCCACAATCCCACTAATGCCACGCTTCACAAAT
TCATCGAGGAACTGAAGAAATATGGGGTGACAACGGTTGT
TAGAGTGTGCGAGGCCACGTATGATGCAAACCTGGTTGTC
AAGGAGGGCATTCAGGTTCTGGATTGGCCCTTTGATGATG
GAGCTCCTCCCTCCAACCAGATTGTTGATGATTGGCTGAA
TCTTCTTCGGGTTAAGTTCAGGGAGGAGCCAGGATGCTGC
ATTGCCGTGCATTGTGTGGCAGGCCTTGGAAGAGCCCCAG
TGCTGGTTGCCCTGGCCCTGATTGAGTGTGGGATGAAGTA
TGAGGATGCTGTTCAATTCATTCGACAAAAGCGGCGTGGA
GCATTTAACAGCAAGCAGCTTTTCTACCTGGAAAAATATC
GTCCCAAAATGCGTCTTCGATTCAAGGATTCCAACGGACA
TCGCACCAACTGCTGCATTCAGTAAAAGATTGCGCATCAG
CTTTTCTCAAATGTTTAATGAGAATTTGTATCTAGCATAA
GAAATATGTTCTCTTAATTGGTAAATGTGAAACTAAAATG
AAGCTTCTTTCATAGTGTCCCATTCCCTCCTCTTCATTTC
TGTATTTCCTGTGGAGAACCTCTGTCAGCAAGGTGAAGTG
CTTGTTTGATGAACATGAGCTTAGTGTTTTGCGAGGAAGT
CGGTTGGTGAACATGGTCAAATCCCGCCTCTGCCAAACTC
GTAGTATGCTTTATTGTCTAAATGGTTTAAATATTTACAT
TTATTGCATTTCTTTTTTGTTCTTGATGATTTGTTTATTT
GTACAAAATGCCTGCCTCCAAAAAGATCTAAAATAAATGC
CTTATCACAGCAGAAAGACACCGTCTGGTGGAGGAGTTCT
CAATGGCATTTGGAGAGGGTTCTTGATGTCTTTTGCAGAA
AAAAAAATAGGAAGAGATTCTGAAGAAAAATCAAGGAAAA
AGAAATGTCTTTATACAAAAATATCGAAGGTTGGAGTACT
AGTTTTCGTTGTTTATCCAAACTTTGTTTACCTATTACTG
CCATGTCAATAGTGTGATGTTTGTGTTTTGGCTTAAAACT
GGACCTCAATGTCTGCGGTATTTTTATGCCTTTTTATTTT
ATGTGCGTAAATTAATATTTCAATACTTGATTTATGTACG
GTATTTGAATATGTGTACTGTTAAATCACCTATTTATATC
AATGGATGTGTTTTAGTATAGGGAGAGACAAGTTGCTACA
AGTTCGCCAATTTGGAAGTACAATAAAGATACACTGAAAG
AA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations