Transcript

ptp4a1-202

ID
ZDB-TSCRIPT-141209-765
Name
ptp4a1-202
Previous Names
  • ptp4a1-004
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060782 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060782|OTTDARG00000034922|ZDB-GENE-041121-11 ptp4a1|OTTDARP00000046970 ptp4a1-004 LG_ BX324177.48 Danio rerio protein_coding KNOWN, 727 bp
GAGCCAGGATGCTGCATTGCCGTGCATTGTGTGGCAGGCC
TTGGAAGAGCCCCAGTGCTGGTTGCCCTGGCCCTGATTGA
GTGTGGGATGAAGTATGAGGATGCTGTTCAATTCATTCGA
CAAAAGCGGCGTGGAGCATTTAACAGCAAGCAGCTTTTCT
ACCTGGAAAAATATCGTCCCAAAATGCGTCTTCGATTCAA
GGATTCCAACGGACATCGCACCAACTGCTGCATTCATGTC
CCATTCCCTCCTCTTCATTTCTGTATTTCCTGTGGAGAAC
CTCTGTCAGCAAGCAGAAAGACACCGTCTGGTGGAGGAGT
TCTCAATGGCATTTGGAGAGGGTTCTTGATGTCTTTTGCA
GAAAAAAAAATAGGAAGAGATTCTGAAGAAAAATCAAGGA
AAAAGAAATGTCTTTATACAAAAATATCGAAGGTTGGAGT
ACTAGTTTTCGTTGTTTATCCAAACTTTGTTTACCTATTA
CTGCCATGTCAATAGTGTGATGTTTGTGTTTTGGCTTAAA
ACTGGACCTCAATGTCTGCGGTATTTTTATGCCTTTTTAT
TTTATGTGCGTAAATTAATATTTCAATACTTGATTTATGT
ACGGTATTTGAATATGTGTACTGTTAAATCACCTATTTAT
ATCAATGGATGTGTTTTAGTATAGGGAGAGACAAGTTGCT
ACAAGTTCGCCAATTTGGAAGTACAATAAAGATACACTGA
AAGAACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations