Transcript

srsf7a-212

ID
ZDB-TSCRIPT-120702-99
Name
srsf7a-212
Previous Names
  • srsf7a-013
  • dkey-85k8.3-013
  • zgc:77155-013
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056182 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056182|OTTDARG00000018399|ZDB-GENE-040426-1798 srsf7a|OTTDARP00000044056 DKEY-85K8.3-013 LG_ BX547938.9 Danio rerio protein_coding KNOWN, 778 bp
GGGCCATTAAGGAGTGTATGGGTCGCCCGGAACCCTCCAG
GTTTCGCCTTCGTAGAGTATGAGGATGCCAGAGATGCAGA
GGATGCCGTAAAGGGGATGGATGGAAAGGTGCTTTGTGGA
GCCCGTGTCAGAGTTGAGCTGTCTAATGGTATGTCCAGAA
AGTCCCGTTATGGCCGTCCCAGCCGCAGGCAATTTGACCC
CAATGACCGCTGTTACCAGTGTGGGGAGACAGGTCATTAT
GCCTACGACTGCTATCGTTTCAGCAAGAGGCGAAGCAGAC
GCAGCAGGTCAGGATCCCCAGGCCGCTCCAGATCCAGAAG
CCCTGGTGGCCGGTCACGTTCACCTGTACGCCGGTCAAAG
AGCCCTGTTCGAAGGTCCAGATCCAGGACACCTCTTCATA
GAGACAGTCGTTCTCGCTCCCGTTCACGGTCTGGTTCCAG
GCAGAGGGATCGCAGTGTCTCCAGATCTCGCTCTCGATCT
CGTTCGATCAGTCACAAGAAAGACAGTCATTCCAGGTCTG
CCAGCCCAAGGAGAAGTCCAACACCGGATGCTGACTGATC
TGAATACTGATGCTTCACCCCCATTCCCCACCTTTGCCTC
AGGGCTGAAATACATTTTATCTTCCCCATGAGTTCAATAC
TGGTTCTATTGTAGCTGCAAAGCTTTTTTTTTTTTTTCTC
GTTCTTCTCCCTTCCCAGAATTCAGTGACACCTCCTCCCA
CCTTGTAAAAACATCACTGTCATCTCAAGCAGCTCATGCA
TATTTTCCCTTTTATCCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations