Transcript

srsf7a-206

ID
ZDB-TSCRIPT-090929-5670
Name
srsf7a-206
Previous Names
  • srsf7a-001
  • zgc:77155-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022309 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022309|OTTDARG00000018399|ZDB-GENE-040426-1798 srsf7a|OTTDARP00000018698 DKEY-85K8.3-001 LG_ BX547938.9 Danio rerio protein_coding KNOWN, 1465 bp
ATCACATTCATGCATTAAAGGCACCGCCTTTTCCTGGAAG
TGAGACAAGTGGACAAGGCCACGCTCGATCAGCAGCTGAC
GGGTGACGCTTCCGGGACAAGAACGCAAGTAGCATGAGAT
AAGAGAATCGCCGTTTCCTCCTTTCAGCCAAGGTTTGGTT
GAAGCGCCTTTAATCAACCGGAAGAAGAAGACGTTCACGC
GCCCTCACACGGAACCGAGGACGTCGAGTCACACAGTGCA
AGATGTCATACTCATCCCGGAGTTCCTCTCGCACCTCTGA
CTGTAAGGTCTATGTGGGTGACCTTGGTAATGGTGCAGCC
AAAGGTGAGCTGGAACGAGCCTTCAGTTACTACGGGCCAT
TAAGGAGTGTATGGGTCGCCCGGAACCCTCCAGGTTTCGC
CTTCGTAGAGTATGAGGATGCCAGAGATGCAGAGGATGCC
GTAAAGGGGATGGATGGAAAGGTGCTTTGTGGAGCCCGTG
TCAGAGTTGAGCTGTCTAATGGTATGTCCAGAAAGTCCCG
TTATGGCCGTCCCAGCCGCAGGCAATTTGACCCCAATGAC
CGCTGTTACCAGTGTGGGGAGACAGGTCATTATGCCTACG
ACTGCTATCGTTTCAGCAAGAGGCGAAGCAGACGCAGCAG
GTCAGGATCTCGTTCCCGGTCCAGATCTCGTGGTCGCCGC
TACCGCTCTCGTAGTCGTAGCAATGAAAGGAGGTACCGTT
CACCTTCATACTCGAAACGCAGAAGCAGGTCAGGATCCCC
AGGCCGCTCCAGATCCAGAAGCCCTGGTGGCCGGTCACGT
TCACCTGTACGCCGGTCAAAGAGCCCTGTTCGAAGGTCCA
GATCCAGGACACCTCTTCATAGAGACAGTCGTTCTCGCTC
CCGTTCACGGTCTGGTTCCAGGCAGAGGGATCGCAGTGTC
TCCAGATCTCGCTCTCGATCTCGTTCGATCAGTCACAAGA
AAGACAGTCATTCCAGGTCTGCCAGCCCAAGGAGAAGTCC
AACACCGGATGCTGACTGATCTGAATACTGATGCTTCACC
CCCATTCCCCACCTTTGCCTCAGGGCTGAAATACATTTTA
TCTTCCCCATGAGTTCAATACTGGTTCTATTGTAGCTGCA
AAGCTTTTTTTTTTTTTTCTCGTTCTTCTCCCTTCCCAGA
ATTCAGTGACACCTCCTCCCACCTTGTAAAAACATCACTG
TCATCTCAAGCAGCTCATGCATATTTTCCCTTTTATCCCC
CCTTCCCTTTGAATTATTTTTTAAGAGCTCAATTATTTTA
ATTTTCAGTGTTGAGCCAGTGTCCTGTGGTCAGTGATTTG
TGGGTAAGGTGGTGAATGAGCTATGTTGTGATTTAGTCAG
TGTATTATATGAACTGAGTACGCTGTGATTTGTTTGTTTG
TAGAAGGTTTTTTTTTTGGCATTGAAAATGGCAATGATCT
TTTTAATAAAGCTTTACAAATCCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations