Transcript

srsf7a-204

ID
ZDB-TSCRIPT-090929-5672
Name
srsf7a-204
Previous Names
  • srsf7a-003
  • zgc:77155-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022311 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022311|OTTDARG00000018399|ZDB-GENE-040426-1798 srsf7a|OTTDARP00000018700 DKEY-85K8.3-003 LG_ BX547938.9 Danio rerio protein_coding KNOWN, 952 bp
GAGACAAGTGGACAAGGCCACGCTCGATCAGCAGCTGACG
GGTGACGCTTCCGGGACAAGAACGCAAGTAGCATGAGATA
AGAGAATCGCCAAGGTTTGGTTGAAGCGCCTTTAATCAAC
CGGAAGAAGAAGACGTTCACGCGCCCTCACACGGAACCGA
GGACGTCGAGTCACACAGTGCAAGATGTCATACTCATCCC
GGAGTTCCTCTCGCACCTCTGACTGTAAGGTCTATGTGGG
TGACCTTGGTAATGGTGCAGCCAAAGGTGAGCTGGAACGA
GCCTTCAGTTACTACGGGCCATTAAGGAGTGTATGGGTCG
CCCGGAACCCTCCAGGTTTCGCCTTCGTAGAGTATGAGGA
TGCCAGAGATGCAGAGGATGCCGTAAAGGGGATGGATGGA
AAGGTGCTTTGTGGAGCCCGTGTCAGAGTTGAGCTGTCTA
ATGGTATGTCCAGAAAGTCCCGTTATGGCCGTCCCAGCCG
CAGGCAATTTGACCCCAATGACCGCTGTTACCAGTGTGGG
GAGACAGGTCATTATGCCTACGACTGCTATCGTTTCAGCA
AGAGGCGAAGCAGACGCAGCAGGTCAGGATCTCGTTCCCG
GTCCAGATCTCGTGGTCGCCGCTACCGCTCTCGTAGTCGT
AGCAATGAAAGGTCAGGATCCCCAGGCCGCTCCAGATCCA
GAAGCCCTGGTGGCCGGTCACGTTCACCTGTACGCCGGTC
AAAGAGCCCTGTTCGAAGGTCCAGATCCAGGACACCTCTT
CATAGAGACAGTCGTTCTCGCTCCCGTTCACGGTCTGGTT
CCAGGCAGAGGGATCGCAGTGTCTCCAGATCTCGCTCTCG
ATCTCGTTCGATCAGTCACAAGAAAGACAGTCATTCCAGG
TCTGCCAGCCCAAGGAGAAGTCCAACACCGGATGCTGACT
GATCTGAATACTGATGCTTCACCCCCATTCCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations